AGRP Logo

AGRP

Asteraceae Genomic Research Platform

Gene Search

Example:
Example:

Gene details

leaf

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Amtr12g00303 ATGTCGAACGCCGTCCTGAACGGCCTTGCCGGAGCCGGCGGAGGTATTATTGCTCAAATCATCACATATCCTCTCCAATCGGTCAACACGCGTCAACAGACGGAGAGAATAGCGAAGAAGTCTCAGAGATCATCTGGCGGTACACTTGTTCAGTTACTTGAGGTTATACGAAGCGAAGGGATTGGGGGATTATACAGCGGCCTTAAGCCATCTCTGCTTGGAACTGCTGCATCACAGGGAATATATTATTATTTTTACCAGGTTTTTAAAAATAAAGCTGAATCTATTGCGGCTTCTAATAAAAGAAAGGGTCGTGGAGATGGAACAGTTGGTATGTTTGGCTGGCTCGTTGTGGCTGCTTTAGCCGGGTCACTGAATGTACTGTTTACAAACCCAATATGGGTGCTTGTGACACGGATGCAGACGCACACTCAAGCAGAACGGAAGATTCTAGAAGCAAAGAAGGAGGCTATGTTAAGAGAGTGTTCCGAAAGCAGTCTGGTTGGTTCTACTTTGCACGATAAGTTGCGTGAACTTGAGTCAGTGAAGCCTAATCCATATGGAACATTGCATGCGGCGTCCGAGGTTTATAACGAAGCTGGAATACGGGGATTTTGGAAAGGCCTTGTTCCTACTTTAATCATGGTGTGCAATCCATCAATTCAGTTCATGATATATGAGACATCTTTAAAGTACTTGAAATCTAAACGTGCCGATAAAACGCAAAGTTCAATTAAAGTTTCTGCTCTGGAGGTATTTGTAGTAGGTGCCATTGCTAAACTTGGAGCAACTGTGACAACATATCCTTTGTTAGTTGTAAAGTCAAGACTTCAAGCAAAGCAAGAAATCAGCACAAACAATTCATTGAGATATTCAGGTACTTTGGATGCAATTGTAAAGATGATTCATTATGAAGGAATATCCAGCTTCTACAAAGGAATGAGCACCAAGATAGTACAAAGTGTATTTGCAGCGTCTGTACTGTTCATGATCAAGGAGGAACTGGTTAACTTTTTTGGAATGCTAGCAAAGAAGAGCCAAAAAATATTATTAAAAATGTCAAATTAG 1068 41.67 MSNAVLNGLAGAGGGIIAQIITYPLQSVNTRQQTERIAKKSQRSSGGTLVQLLEVIRSEGIGGLYSGLKPSLLGTAASQGIYYYFYQVFKNKAESIAASNKRKGRGDGTVGMFGWLVVAALAGSLNVLFTNPIWVLVTRMQTHTQAERKILEAKKEAMLRECSESSLVGSTLHDKLRELESVKPNPYGTLHAASEVYNEAGIRGFWKGLVPTLIMVCNPSIQFMIYETSLKYLKSKRADKTQSSIKVSALEVFVVGAIAKLGATVTTYPLLVVKSRLQAKQEISTNNSLRYSGTLDAIVKMIHYEGISSFYKGMSTKIVQSVFAASVLFMIKEELVNFFGMLAKKSQKILLKMSN 355
leaf

Annotation information

Select Seq ID Length Analysis Description Start End IPR GO
Amtr12g00303 355 Gene3D Mitochondrial carrier domain 9 350 IPR023395 -
Amtr12g00303 355 SUPERFAMILY Mitochondrial carrier 4 334 IPR023395 -
Amtr12g00303 355 PANTHER MITOCHONDRIAL NICOTINAMIDE ADENINE DINUCLEOTIDE TRANSPORTER 1-RELATED-RELATED 3 350 IPR044712 GO:0006862(InterPro)|GO:0022857(PANTHER)|GO:0055085(PANTHER)|GO:0055085(InterPro)
Amtr12g00303 355 ProSiteProfiles Solute carrier (Solcar) repeat profile. 247 338 IPR018108 -
Amtr12g00303 355 ProSiteProfiles Solute carrier (Solcar) repeat profile. 110 232 IPR018108 -
Amtr12g00303 355 Pfam Mitochondrial carrier protein 248 339 IPR018108 -
Amtr12g00303 355 Pfam Mitochondrial carrier protein 187 236 IPR018108 -
Amtr12g00303 355 Pfam Mitochondrial carrier protein 5 91 IPR018108 -
Amtr12g00303 355 ProSiteProfiles Solute carrier (Solcar) repeat profile. 2 92 IPR018108 -
leaf

Pathway information

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Amtr12g00303 K13354 solute carrier family 25 (peroxisomal adenine nucleotide transporter), member 17
leaf

Duplication type information

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
198057 Amtr Amtr02g04846 Amtr-Chr2:91030787 Amtr12g00303 Amtr-Chr12:9173436
271191 Amtr Amtr12g00303 Amtr-Chr12:9173436 Amtr07g02097 Amtr-Chr7:29164512
leaf

Gene Family Members

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Amtr01g02384 . 1 236 Chloroplast and Mitochondria gene family AT1G26100 63.265 9.66e-95 276.0
Amtr01g06275 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 56.219 8.16e-76 229.0
Amtr01g06578 ACH 1 367 Chloroplast and Mitochondria gene family AT5G14040 71.935 0.0 542.0
Amtr01g06713 . 54 354 Chloroplast and Mitochondria gene family AT5G54290 77.076 5.41e-147 417.0
Amtr01g07159 . 1 239 Chloroplast and Mitochondria gene family AT4G25570 64.017 2.61e-109 312.0
Amtr01g08173 ACH 1 307 Chloroplast and Mitochondria gene family AT5G40810 84.194 5.56e-180 497.0
Amtr01g08385 . 1 228 Chloroplast and Mitochondria gene family AT5G38630 67.544 5.89e-114 323.0
Amtr01g08722 . 33 308 Chloroplast and Mitochondria gene family AT1G25380 34.035 4.72e-44 152.0
Amtr01g09186 WGDA 33 300 Chloroplast and Mitochondria gene family AT1G25380 28.716 4.16e-14 70.5
Amtr02g00011 . 37 318 Chloroplast and Mitochondria gene family AT1G07030 32.042 2.98e-32 120.0
Amtr02g01144 . 33 327 Chloroplast and Mitochondria gene family AT1G25380 65.449 2.33e-142 405.0
Amtr02g02172 . 1 258 Chloroplast and Mitochondria gene family AT1G15820 82.375 7.72e-150 417.0
Amtr02g03218 WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 71.137 1.54e-167 469.0
Amtr02g03837 WGDA 33 294 Chloroplast and Mitochondria gene family AT1G25380 27.931 7.30e-13 66.6
Amtr02g04048 . 18 273 Chloroplast and Mitochondria gene family AT1G61520 89.453 5.70e-171 471.0
Amtr02g04154 . 2 264 Chloroplast and Mitochondria gene family AT2G05070 67.286 3.32e-123 350.0
Amtr02g04846 . 37 310 Chloroplast and Mitochondria gene family AT1G25380 26.471 7.89e-29 112.0
Amtr02g05248 . 5 309 Chloroplast and Mitochondria gene family AT2G17270 64.918 6.81e-151 424.0
Amtr02g05550 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.313 2.09e-165 456.0
Amtr02g05549 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.266 4.64e-167 461.0
Amtr02g05548 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.266 3.20e-167 461.0
Amtr02g07076 . 3 280 Chloroplast and Mitochondria gene family AT4G10340 83.871 1.82e-154 430.0
Amtr02g08142 WGDA 1 265 Chloroplast and Mitochondria gene family AT2G05100 89.434 0.0 497.0
Amtr03g01295 . 51 255 Chloroplast and Mitochondria gene family AT3G61470 66.829 1.50e-101 295.0
Amtr03g02091 . 12 316 Chloroplast and Mitochondria gene family AT1G07030 31.27 1.50e-33 129.0
Amtr03g02092 . 12 316 Chloroplast and Mitochondria gene family AT1G07030 30.671 1.26e-33 129.0
Amtr03g03658 . 2 265 Chloroplast and Mitochondria gene family AT2G05100 67.041 1.52e-121 345.0
Amtr03g04571 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 56.219 8.62e-76 229.0
Amtr03g05001 . 37 254 Chloroplast and Mitochondria gene family AT3G61470 45.249 6.66e-60 189.0
Amtr03g05506 . 1 343 Chloroplast and Mitochondria gene family AT1G72820 66.857 1.67e-166 466.0
Amtr03g05868 ACH 70 363 Chloroplast and Mitochondria gene family AT5G14040 80.952 0.0 506.0
Amtr03g06281 WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 85.342 0.0 508.0
Amtr04g00316 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.687 1.61e-172 474.0
Amtr04g00317 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.94 2.44e-170 469.0
Amtr04g02092 . 43 548 Chloroplast and Mitochondria gene family AT2G18710 80.664 0.0 834.0
Amtr04g02800 ACH 1 71 Chloroplast and Mitochondria gene family AT5G05370 66.197 8.16e-33 106.0
Amtr04g02847 . 1 253 Chloroplast and Mitochondria gene family AT1G72820 61.66 4.06e-104 303.0
Amtr05g02957 ACH 5 111 Chloroplast and Mitochondria gene family AT5G14040 56.364 7.51e-31 110.0
Amtr05g02958 . 257 373 Chloroplast and Mitochondria gene family AT5G14040 81.197 3.43e-63 194.0
Amtr05g03670 ACH 1 364 Chloroplast and Mitochondria gene family AT5G14040 72.802 0.0 536.0
Amtr05g05493 . 26 327 Chloroplast and Mitochondria gene family AT1G76570 76.49 6.67e-178 493.0
Amtr06g03332 . 18 273 Chloroplast and Mitochondria gene family AT1G61520 89.453 7.26e-171 471.0
Amtr06g06182 . 6 143 Chloroplast and Mitochondria gene family AT1G07020 45.27 5.11e-28 99.8
Amtr07g00174 . 20 354 Chloroplast and Mitochondria gene family AT2G28800 20.282 3.92e-09 56.6
Amtr07g00620 . 33 254 Chloroplast and Mitochondria gene family AT3G61470 90.991 4.69e-150 417.0
Amtr07g01172 WGDA 1 265 Chloroplast and Mitochondria gene family AT2G05100 89.811 0.0 497.0
Amtr07g03255 . 1 258 Chloroplast and Mitochondria gene family AT1G15820 80.233 5.05e-148 412.0
Amtr07g04742 . 11 320 Chloroplast and Mitochondria gene family AT5G15640 70.0 8.49e-170 472.0
Amtr07g04743 . 7 320 Chloroplast and Mitochondria gene family AT5G15640 73.248 2.59e-176 489.0
Amtr07g05107 ACH,WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 84.74 0.0 505.0
Amtr08g00815 . 1 147 Chloroplast and Mitochondria gene family AT1G72820 64.865 3.74e-60 187.0
Amtr08g04028 ACH 2 373 Chloroplast and Mitochondria gene family AT5G14040 75.806 0.0 567.0
Amtr08g04452 . 1 297 Chloroplast and Mitochondria gene family AT2G17270 68.35 1.53e-160 447.0
Amtr08g04718 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 88.06 1.54e-172 475.0
Amtr08g04719 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.313 2.67e-169 466.0
Amtr08g05593 . 14 287 Chloroplast and Mitochondria gene family AT5G01530 82.482 7.83e-164 454.0
Amtr09g02535 . 36 407 Chloroplast and Mitochondria gene family AT2G28800 60.152 4.87e-158 457.0
Amtr09g03282 ACH 4 214 Chloroplast and Mitochondria gene family AT4G25570 44.076 3.18e-62 192.0
Amtr09g03283 . 1 224 Chloroplast and Mitochondria gene family AT1G14730 59.375 5.30e-91 265.0
Amtr09g04015 . 1 239 Chloroplast and Mitochondria gene family AT3G54890 83.333 2.11e-145 404.0
Amtr10g00428 WGDA 22 224 Chloroplast and Mitochondria gene family AT5G38630 40.887 7.75e-50 160.0
Amtr10g00602 WGDA 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.567 3.58e-170 469.0
Amtr10g04619 ACH,WGDA 4 211 Chloroplast and Mitochondria gene family AT4G25570 44.231 7.31e-62 191.0
Amtr10g04814 WGDA 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.142 1.15e-170 470.0
Amtr11g02644 . 1 343 Chloroplast and Mitochondria gene family AT1G72820 67.93 2.93e-159 447.0
Amtr11g02932 . 4 271 Chloroplast and Mitochondria gene family AT4G03320 34.42 1.13e-42 145.0
Amtr11g03048 . 1 258 Chloroplast and Mitochondria gene family AT1G15820 80.843 5.03e-150 417.0
Amtr11g03711 WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 67.341 1.32e-158 446.0
Amtr11g03813 . 4 187 Chloroplast and Mitochondria gene family AT1G17530 62.5 5.85e-71 211.0
Amtr11g03896 . 1 343 Chloroplast and Mitochondria gene family AT1G72820 66.954 5.34e-158 444.0
Amtr11g04276 . 1 300 Chloroplast and Mitochondria gene family AT4G25700 65.528 2.30e-144 407.0
Amtr12g00303 . 33 300 Chloroplast and Mitochondria gene family AT2G47490 30.721 1.64e-30 116.0
Amtr12g00348 . 1 307 Chloroplast and Mitochondria gene family AT2G47490 77.922 2.15e-166 463.0
Amtr12g01174 ACH 1 72 Chloroplast and Mitochondria gene family AT5G05370 66.667 2.30e-33 107.0
Amtr12g01238 . 1 327 Chloroplast and Mitochondria gene family AT2G30160 67.953 2.53e-162 454.0
Amtr12g01679 . 15 287 Chloroplast and Mitochondria gene family AT5G01530 80.657 3.40e-158 440.0