AGRP Logo

AGRP

Asteraceae Genomic Research Platform

Gene Search

Example:
Example:

Gene details

leaf

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Bial22g00870 ATGTCTAACGCCGTTCTGAACGGGCTGGCGGGAGCTGGCGGAGGCATCATTGCTCAAATCATTACATATCCTCTCCAATCGGTCAACACCCGCCAACAGACGGAGAGAATCGCCAAGAAATCTCACTCCAGGAGTTCATCCCACGGTGGTACACTTGTTCAATTACTCCAGGTTATACGAAGCGAAGGAATTGGAGGATTATACAGCGGCCTTAAGCCATCTCTGCTTGGAACTGCTGCATCACAGGGAATTTATTATTATTTTTACCAGGTTTTCAAAAATAAAGCTGAATCAATTGCAGCTTCTAATAAAAGGAAGGGTCATGGAGATGGTACAGTTGGTATGTTATCTTGGCTTGTTGTGGCTGCTTTAGCCGGGTCACTGAATGTACTGTTTACAAATCCAATATGGGTTCTTGTGACACGTATGCAGACACACACTCAAGCAGAACAAAAGATTCTAGAAGCAAAGAAAGAAGCTTTGTTAAGAGAATGTTCTGAAAGCAATCTGGTTGGCTCTTCTTTACACGATAAGTTGCGTGAACTCGACTCAGTGAAACCTAATCCGTATGGAACACTGCACGCGGCTCACGAGGTTTATACCGAAGCTGGAATACGTGGATTTTGGAAGGGCCTTGTTCCTACTTTAATCATGGTGTGCAATCCATCGATTCAGTTCATGATATACGAGACATCTTTGAAGTACTTGAAATCTAAACGTGCGGAAAAGAAGCAAAGTTCAAATAAAATTTCTGCTTTGGAGGTATTTGTAGTTGGTGCCATTGCTAAACTTGGAGCAACTGTGACAACATACCCTTTGTTAGTTGTAAAGTCAAGACTTCAAGCTAAGCAAGAAATCAGTACAAACAATTCGTTAAGATATTCAGGTACATTGGATGCAATTGTGAAGATGATTCATTATGAAGGAATATCAAGCTTCTACAAAGGAATGAGCACCAAGATAGTGCAGAGTGTATTTGCAGCTTCTGTACTTTTCATGATCATGGAGGAGTTGGTTAATTTTTTTGGAATGTTAGCAAAGAAGAGCCAAAAGATGTTATTAAAAATGTCAAATTAG 1077 40.76 MSNAVLNGLAGAGGGIIAQIITYPLQSVNTRQQTERIAKKSHSRSSSHGGTLVQLLQVIRSEGIGGLYSGLKPSLLGTAASQGIYYYFYQVFKNKAESIAASNKRKGHGDGTVGMLSWLVVAALAGSLNVLFTNPIWVLVTRMQTHTQAEQKILEAKKEALLRECSESNLVGSSLHDKLRELDSVKPNPYGTLHAAHEVYTEAGIRGFWKGLVPTLIMVCNPSIQFMIYETSLKYLKSKRAEKKQSSNKISALEVFVVGAIAKLGATVTTYPLLVVKSRLQAKQEISTNNSLRYSGTLDAIVKMIHYEGISSFYKGMSTKIVQSVFAASVLFMIMEELVNFFGMLAKKSQKMLLKMSN 358
leaf

Annotation information

Select Seq ID Length Analysis Description Start End IPR GO
Bial22g00870 358 ProSiteProfiles Solute carrier (Solcar) repeat profile. 2 95 IPR018108 -
Bial22g00870 358 ProSiteProfiles Solute carrier (Solcar) repeat profile. 250 341 IPR018108 -
Bial22g00870 358 SUPERFAMILY Mitochondrial carrier 4 337 IPR023395 -
Bial22g00870 358 Pfam Mitochondrial carrier protein 250 342 IPR018108 -
Bial22g00870 358 Pfam Mitochondrial carrier protein 5 94 IPR018108 -
Bial22g00870 358 Pfam Mitochondrial carrier protein 190 239 IPR018108 -
Bial22g00870 358 Gene3D Mitochondrial carrier domain 7 354 IPR023395 -
Bial22g00870 358 PANTHER MITOCHONDRIAL NICOTINAMIDE ADENINE DINUCLEOTIDE TRANSPORTER 1-RELATED-RELATED 3 351 IPR044712 GO:0006862(InterPro)|GO:0022857(PANTHER)|GO:0055085(InterPro)|GO:0055085(PANTHER)
Bial22g00870 358 ProSiteProfiles Solute carrier (Solcar) repeat profile. 113 235 IPR018108 -
leaf

Pathway information

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Bial22g00870 K13354 solute carrier family 25 (peroxisomal adenine nucleotide transporter), member 17
leaf

Duplication type information

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
670666 Bial Bial10g00794 Bial-Chr10:8080344 Bial22g00870 Bial-Chr22:8339808
706937 Bial Bial22g00437 Bial-Chr22:4154897 Bial22g00870 Bial-Chr22:8339808
707292 Bial Bial22g00870 Bial-Chr22:8339808 Bial5g00245 Bial-Chr5:3297419
782161 Bial Bial10g01278 Bial-Chr10:12779538 Bial22g00870 Bial-Chr22:8339808
leaf

Gene Family Members

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Bial12g01302 . 1 280 Chloroplast and Mitochondria gene family AT4G10340 80.277 3.49e-151 425.0
Bial4g01339 . 51 254 Chloroplast and Mitochondria gene family AT3G61470 66.176 2.19e-99 293.0
Bial12g00477 . 36 300 Chloroplast and Mitochondria gene family AT4G25700 72.963 2.92e-142 401.0
Bial14g00248 BST,WGDA 5 183 Chloroplast and Mitochondria gene family AT1G17530 61.202 1.13e-69 209.0
Bial14g00110 BST,WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 68.513 2.51e-160 450.0
Bial18g02954 BST,WGDA 143 354 Chloroplast and Mitochondria gene family AT2G28800 20.179 4.82e-06 47.0
Bial18g02413 . 33 252 Chloroplast and Mitochondria gene family AT3G61470 91.818 5.57e-150 419.0
Bial2g00379 ACH,BST,WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 68.513 2.16e-160 450.0
Bial2g00523 ACH,BST,WGDA 5 183 Chloroplast and Mitochondria gene family AT1G17530 61.202 4.38e-69 207.0
Bial2g00838 ACH,BST,WGDA 153 253 Chloroplast and Mitochondria gene family AT1G15820 77.228 5.29e-52 164.0
Bial2g01083 BST,WGDA 9 316 Chloroplast and Mitochondria gene family AT1G07030 30.696 1.02e-34 127.0
Bial2g01265 . 2 265 Chloroplast and Mitochondria gene family AT2G05100 67.416 1.65e-121 346.0
Bial2g01266 . 46 265 Chloroplast and Mitochondria gene family AT2G05100 74.888 2.14e-117 333.0
Bial2g01683 BST,WGDA 3 373 Chloroplast and Mitochondria gene family AT5G14040 77.089 0.0 575.0
Bial8g01774 BST 87 271 Chloroplast and Mitochondria gene family AT4G03320 40.0 4.14e-42 142.0
Bial12g00835 ACH,WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 84.691 0.0 509.0
Bial24g00256 . 14 107 Chloroplast and Mitochondria gene family AT3G08940 69.474 2.06e-43 139.0
Bial24g00257 . 148 287 Chloroplast and Mitochondria gene family AT5G01530 82.143 2.49e-75 223.0
Bial4g01938 . 70 548 Chloroplast and Mitochondria gene family AT2G18710 84.342 0.0 820.0
Bial3g03553 ACH,BST,WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 69.143 8.01e-165 462.0
Bial3g03402 ACH,BST,WGDA 9 187 Chloroplast and Mitochondria gene family AT1G17530 63.128 1.04e-72 216.0
Bial3g03080 ACH 1 71 Chloroplast and Mitochondria gene family AT5G05370 67.606 3.78e-34 110.0
Bial3g03051 ACH,BST 1 57 Chloroplast and Mitochondria gene family AT5G05370 70.175 1.82e-27 93.2
Bial24g00798 WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 85.016 0.0 512.0
Bial9g00405 . 4 580 Chloroplast and Mitochondria gene family AT4G21490 66.265 0.0 793.0
Bial3g02823 ACH,BST,WGDA 1 258 Chloroplast and Mitochondria gene family AT1G15820 83.721 2.29e-152 423.0
Bial8g01013 . 1 239 Chloroplast and Mitochondria gene family AT3G54890 82.917 1.35e-141 403.0
Bial8g00089 . 79 404 Chloroplast and Mitochondria gene family AT2G28800 64.368 1.67e-154 447.0
Bial8g00494 WGDA 7 319 Chloroplast and Mitochondria gene family AT1G25380 44.937 1.58e-70 219.0
Bial8g00676 BST 4 131 Chloroplast and Mitochondria gene family AT4G25570 47.656 1.88e-39 130.0
Bial8g00677 BST 1 223 Chloroplast and Mitochondria gene family AT1G14730 61.435 5.68e-94 273.0
Bial22g00437 BST 37 321 Chloroplast and Mitochondria gene family AT1G25380 24.843 7.41e-28 109.0
Bial6g00413 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.94 9.50e-171 470.0
Bial12g03598 BST 52 447 Chloroplast and Mitochondria gene family AT2G28800 77.078 0.0 601.0
Bial12g02385 . 18 273 Chloroplast and Mitochondria gene family AT1G61520 87.5 2.79e-167 462.0
Bial13g01471 . 33 214 Chloroplast and Mitochondria gene family AT1G07030 29.891 9.61e-20 88.6
Bial4g03437 . 1 273 Chloroplast and Mitochondria gene family AT1G61520 87.546 2.72e-170 469.0
Bial4g00486 . 6 267 Chloroplast and Mitochondria gene family AT1G29930 69.202 1.32e-120 341.0
Bial4g00485 . 2 267 Chloroplast and Mitochondria gene family AT1G29930 85.768 6.01e-168 463.0
Bial4g00483 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 85.821 1.26e-169 467.0
Bial23g02048 . 3 280 Chloroplast and Mitochondria gene family AT4G10340 82.918 3.57e-151 422.0
Bial23g02049 . 109 280 Chloroplast and Mitochondria gene family AT4G10340 86.047 8.18e-98 282.0
Bial23g02153 . 51 254 Chloroplast and Mitochondria gene family AT3G61470 48.309 5.66e-60 189.0
Bial18g03467 ACH 1 228 Chloroplast and Mitochondria gene family AT5G38630 66.228 1.76e-111 318.0
Bial10g03451 BST 3 143 Chloroplast and Mitochondria gene family AT1G07020 44.366 4.36e-24 89.4
Bial12g01809 BST,WGDA 26 307 Chloroplast and Mitochondria gene family AT5G40810 86.219 6.28e-173 479.0
Bial23g01367 . 1 307 Chloroplast and Mitochondria gene family AT5G40810 84.691 0.0 506.0
Bial6g03381 . 1 190 Chloroplast and Mitochondria gene family AT3G08940 70.769 1.60e-90 263.0
Bial1g00481 ACH,BST 37 318 Chloroplast and Mitochondria gene family AT1G07030 31.69 5.54e-32 120.0
Bial22g00075 . 2 369 Chloroplast and Mitochondria gene family AT5G14040 76.63 0.0 574.0
Bial1g00510 . 1 239 Chloroplast and Mitochondria gene family AT3G54890 85.417 2.21e-144 402.0
Bial7g04073 . 26 292 Chloroplast and Mitochondria gene family AT2G17270 59.48 1.32e-112 323.0
Bial20g02475 ACH,BST 1 367 Chloroplast and Mitochondria gene family AT5G14040 70.845 0.0 537.0
Bial13g00594 . 1 239 Chloroplast and Mitochondria gene family AT3G54890 85.417 2.21e-144 402.0
Bial20g02264 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 55.224 2.88e-75 227.0
Bial20g02265 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 55.224 1.19e-74 226.0
Bial23g00092 . 1 239 Chloroplast and Mitochondria gene family AT4G25570 63.9 1.18e-105 303.0
Bial11g02285 . 109 280 Chloroplast and Mitochondria gene family AT4G10340 86.047 8.18e-98 282.0
Bial11g02284 . 3 280 Chloroplast and Mitochondria gene family AT4G10340 82.918 3.57e-151 422.0
Bial9g00502 . 33 254 Chloroplast and Mitochondria gene family AT3G61470 91.892 2.54e-151 421.0
Bial13g00300 BST,WGDA 33 327 Chloroplast and Mitochondria gene family AT1G25380 66.113 1.08e-140 401.0
Bial1g02730 ACH,BST,WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 64.431 5.18e-148 419.0
Bial24g02242 . 18 273 Chloroplast and Mitochondria gene family AT1G61520 87.5 2.64e-167 462.0
Bial22g02812 BST 192 300 Chloroplast and Mitochondria gene family AT1G25380 24.59 3.20e-06 43.9
Bial22g03098 BST 3 143 Chloroplast and Mitochondria gene family AT1G07020 43.662 1.74e-23 87.8
Bial2g02961 . 22 224 Chloroplast and Mitochondria gene family AT5G38630 41.379 5.64e-53 168.0
Bial11g02558 . 35 255 Chloroplast and Mitochondria gene family AT3G61470 50.679 1.80e-73 223.0
Bial11g02320 . 38 254 Chloroplast and Mitochondria gene family AT3G61470 38.636 4.42e-52 170.0
Bial9g02373 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 85.821 1.03e-167 462.0
Bial17g01161 ACH,BST 1 364 Chloroplast and Mitochondria gene family AT5G14040 73.901 0.0 544.0
Bial19g01546 ACH,BST,WGDA 1 228 Chloroplast and Mitochondria gene family AT5G38630 67.544 3.30e-114 324.0
Bial19g01720 ACH,BST,WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 85.161 0.0 509.0
Bial19g02550 . 14 287 Chloroplast and Mitochondria gene family AT5G01530 83.942 2.32e-165 458.0
Bial10g02066 . 6 266 Chloroplast and Mitochondria gene family AT2G34430 86.973 1.22e-166 459.0
Bial10g02065 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.64 3.53e-171 471.0
Bial10g02019 . 15 287 Chloroplast and Mitochondria gene family AT5G01530 82.482 7.14e-159 442.0
Bial10g01786 BST,WGDA 51 449 Chloroplast and Mitochondria gene family AT2G28800 68.719 1.11e-179 508.0
Bial10g01681 BST 1 329 Chloroplast and Mitochondria gene family AT2G30160 70.181 6.96e-167 466.0
Bial10g01293 BST 1 307 Chloroplast and Mitochondria gene family AT2G47490 75.563 6.98e-162 452.0
Bial10g01278 BST 56 306 Chloroplast and Mitochondria gene family AT1G25380 23.507 1.17e-07 53.9
Bial10g00794 BST 37 321 Chloroplast and Mitochondria gene family AT1G25380 24.375 3.41e-28 110.0
Bial16g01812 . 1 72 Chloroplast and Mitochondria gene family AT5G05370 65.278 4.47e-34 109.0
Bial16g01800 . 68 346 Chloroplast and Mitochondria gene family AT1G72820 51.254 4.79e-83 249.0
Bial22g01200 BST 1 329 Chloroplast and Mitochondria gene family AT2G30160 70.181 1.08e-166 465.0
Bial5g01340 ACH,BST 1 356 Chloroplast and Mitochondria gene family AT5G14040 73.315 0.0 526.0
Bial5g02306 . 33 254 Chloroplast and Mitochondria gene family AT3G61470 90.991 3.84e-150 418.0
Bial5g02792 BST,WGDA 143 354 Chloroplast and Mitochondria gene family AT2G28800 20.179 4.82e-06 47.0
Bial7g01127 BST,WGDA 33 322 Chloroplast and Mitochondria gene family AT1G25380 28.75 6.85e-14 70.9
Bial7g01537 ACH,BST,WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 84.839 0.0 504.0
Bial7g01707 ACH,BST,WGDA 1 228 Chloroplast and Mitochondria gene family AT5G38630 67.544 5.96e-114 323.0
Bial7g01893 ACH,BST,WGDA 29 300 Chloroplast and Mitochondria gene family AT2G47490 36.429 6.00e-47 158.0
Bial7g02545 . 14 287 Chloroplast and Mitochondria gene family AT5G01530 83.942 2.32e-165 458.0
Bial8g02657 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 55.224 2.42e-75 228.0
Bial8g02658 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 55.224 1.44e-74 226.0
Bial8g02840 ACH,BST 1 367 Chloroplast and Mitochondria gene family AT5G14040 61.905 0.0 518.0
Bial8g02939 . 61 354 Chloroplast and Mitochondria gene family AT5G54290 78.571 2.14e-145 414.0
Bial14g01312 . 3 108 Chloroplast and Mitochondria gene family AT5G14040 51.887 1.46e-25 97.1
Bial14g01313 BST,WGDA 3 373 Chloroplast and Mitochondria gene family AT5G14040 76.28 0.0 569.0
Bial14g01672 BST,WGDA 26 292 Chloroplast and Mitochondria gene family AT2G17270 62.172 4.83e-120 343.0
Bial14g01851 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.687 2.34e-170 469.0
Bial14g01852 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 88.433 4.36e-172 474.0
Bial23g02326 . 35 255 Chloroplast and Mitochondria gene family AT3G61470 51.131 4.32e-74 224.0
Bial24g01675 BST,WGDA 26 270 Chloroplast and Mitochondria gene family AT3G27240 54.183 2.06e-75 231.0
Bial14g03168 . 15 287 Chloroplast and Mitochondria gene family AT5G01530 85.348 6.19e-163 462.0
Bial21g02443 . 4 216 Chloroplast and Mitochondria gene family AT4G25570 42.723 3.60e-58 182.0
Bial21g02311 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 85.448 2.18e-167 462.0
Bial15g03051 ACH,BST,WGDA 1 258 Chloroplast and Mitochondria gene family AT1G15820 83.721 6.29e-153 424.0
Bial15g03277 ACH,BST 1 72 Chloroplast and Mitochondria gene family AT5G05370 66.667 8.91e-35 111.0
Bial19g00039 . 103 327 Chloroplast and Mitochondria gene family AT1G76570 71.111 4.89e-115 328.0
Bial22g01608 . 6 266 Chloroplast and Mitochondria gene family AT2G34430 87.356 5.87e-167 460.0
Bial22g01607 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.64 8.77e-171 470.0
Bial22g01550 . 15 287 Chloroplast and Mitochondria gene family AT5G01530 82.847 1.74e-159 444.0
Bial22g01303 BST,WGDA 51 449 Chloroplast and Mitochondria gene family AT2G28800 77.586 0.0 608.0
Bial16g01168 ACH,WGDA 51 252 Chloroplast and Mitochondria gene family AT3G61470 56.931 5.11e-77 238.0
Bial20g01643 BST 118 271 Chloroplast and Mitochondria gene family AT4G03320 40.506 2.08e-37 127.0
Bial20g02545 BST 61 354 Chloroplast and Mitochondria gene family AT5G54290 56.818 3.05e-87 266.0
Bial18g00529 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.94 9.50e-171 470.0
Bial18g00362 . 149 220 Chloroplast and Mitochondria gene family AT1G14730 40.278 2.69e-13 62.0
Bial15g01579 . 1 265 Chloroplast and Mitochondria gene family AT2G05070 89.057 1.50e-179 492.0
Bial15g01578 . 1 265 Chloroplast and Mitochondria gene family AT2G05070 89.057 6.65e-180 493.0
Bial12g00190 . 14 287 Chloroplast and Mitochondria gene family AT5G01530 64.234 1.49e-106 307.0
Bial16g02831 . 1 273 Chloroplast and Mitochondria gene family AT1G61520 81.319 1.45e-152 424.0
Bial3g01650 . 50 265 Chloroplast and Mitochondria gene family AT2G05070 93.519 2.00e-151 419.0
Bial3g01649 . 1 265 Chloroplast and Mitochondria gene family AT2G05070 89.057 6.65e-180 493.0
Bial16g00455 . 83 266 Chloroplast and Mitochondria gene family AT2G34430 85.326 3.52e-111 316.0
Bial16g00459 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.567 5.87e-170 468.0
Bial20g00419 BST 1 223 Chloroplast and Mitochondria gene family AT1G14730 61.435 4.87e-94 273.0
Bial20g00418 BST 4 131 Chloroplast and Mitochondria gene family AT4G25570 48.438 1.25e-39 131.0
Bial10g00008 . 4 306 Chloroplast and Mitochondria gene family AT2G17270 62.379 1.13e-146 413.0
Bial10g00043 ACH,BST,WGDA 33 308 Chloroplast and Mitochondria gene family AT1G25380 36.842 2.01e-48 164.0
Bial10g00310 ACH 2 369 Chloroplast and Mitochondria gene family AT5G14040 66.146 1.39e-173 485.0
Bial23g00828 BST 128 236 Chloroplast and Mitochondria gene family AT1G26100 61.468 1.46e-33 114.0
Bial23g02707 . 1 345 Chloroplast and Mitochondria gene family AT1G72820 70.115 1.28e-174 486.0
Bial22g00887 BST 1 307 Chloroplast and Mitochondria gene family AT2G47490 75.563 6.98e-162 452.0
Bial22g00870 . 37 306 Chloroplast and Mitochondria gene family AT1G25380 26.625 1.10e-29 115.0
Bial24g03421 BST,WGDA 52 447 Chloroplast and Mitochondria gene family AT2G28800 64.987 1.29e-165 471.0
Bial7g00033 . 42 325 Chloroplast and Mitochondria gene family AT1G76570 79.93 7.68e-176 488.0
Bial24g01233 . 3 280 Chloroplast and Mitochondria gene family AT4G10340 81.851 2.67e-153 427.0
Bial11g00093 . 1 239 Chloroplast and Mitochondria gene family AT4G25570 64.167 7.70e-102 311.0
Bial19g01081 BST 33 322 Chloroplast and Mitochondria gene family AT1G25380 28.75 9.29e-14 70.5
Bial19g01353 ACH,BST,WGDA 29 210 Chloroplast and Mitochondria gene family AT2G47490 37.297 2.14e-28 107.0
Bial14g00922 . 2 265 Chloroplast and Mitochondria gene family AT2G05100 67.79 4.90e-122 347.0
Bial14g00921 . 2 264 Chloroplast and Mitochondria gene family AT2G05070 66.543 9.24e-122 346.0
Bial1g00237 BST,WGDA 200 327 Chloroplast and Mitochondria gene family AT1G25380 57.252 5.87e-51 166.0
Bial13g02946 ACH,BST,WGDA 6 343 Chloroplast and Mitochondria gene family AT1G72820 63.905 1.10e-144 410.0
Bial11g01862 . 1 263 Chloroplast and Mitochondria gene family AT5G15640 70.342 3.94e-138 391.0
Bial11g01861 . 1 320 Chloroplast and Mitochondria gene family AT5G15640 72.5 1.37e-177 492.0
Bial11g01633 ACH,BST,WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 85.016 0.0 506.0
Bial11g01137 BST 10 236 Chloroplast and Mitochondria gene family AT1G26100 65.546 3.57e-95 277.0
Bial6g01931 ACH,BST,WGDA 1 297 Chloroplast and Mitochondria gene family AT2G17270 69.667 1.98e-161 450.0
Bial6g02085 . 6 267 Chloroplast and Mitochondria gene family AT1G29930 87.833 1.19e-167 462.0
Bial6g02086 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 88.06 5.74e-172 473.0