AGRP Logo

AGRP

Asteraceae Genomic Research Platform

Gene Search

Example:
Example:

Gene details

leaf

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cind3g04280 ATGGCTTTGATGAACACACAATTACTAATTCAGATAACCATAATTGGCGCTATATTGGCAGTTGGATCAAGTAACCCTAACGTCCAACAGGGTCCCCAAAATTGGAACTTCGGTTTCAACTATACCAATGAGCCTTTTAGACACCCGAATCCTTTTCAGAATTCTAGAAGAGTCATTGTTGGTGGTTCTGATAATTGGCGTTTTGGCTTTAACTACACTGAATGGGCTCGTACGAATGCCCCATTTTACTTCAACGATACTCTAGTGGAAGATACCTACGTCTTTTTGATGAAATGGATTCATGACGGGTACCCCGCTTACAATAGAAGGGCTTTGTATTTGATTGGGATTAGAAATGGGCTTGCCGATGATAAAAGTGATACAAAGGGACTTATTGACTATGCTTGGACCAATTTCCTGTTCGCAGACGAATCCCGTGAAGATTTTATGGGAAAACTCTCGCTCGACTTTAACAAAAGTCATGGATGCAAATTGGCAATTCGGAGCTATGTCACGGACCCTTGTGTTCTAGCTTTGGGCATAAAATATGCATTGGAAAGTATGGGTCTGGATGTCATCGAGCAATGGCATATGTGGTTGCTACCAGAAATTAGAAATGGGCTTGCCGATGAAAAAAGTGATATAAAGGGGCTTATTGACTATGCTTGGACCAATTCCTTGTTCGCTAACGAATCCAGTGAAGAGTTTATGGGAAAATTCTCTCTCGACTTTAACAAAAGTCATGGATGCAGATTGGCAATTCAGAGCTTGCAGAATTGTGTTATTTGTCACGGCTTTGAACTGGTGTTATTCAAGAGACTATCTTCTAAGATCTTTGTATCCAATAATCTGGAAGCATGCAGATGCCGACTCTCAGCCGTTGTGCAACAACAAAATCAGCAACAACAGCAACAGATGGTTCCATTACAAGACAGTTACATGCAGATCAGAGCTGAGGCTCTTCACAACATTGAGTCAACTATTCACGACTTAGGCAACATTTTCACACAATTGGCGACCATGGTTTCTCAGCAAGGGGACCTTGCAATTAGAAGGATGGAATCACTAAAAGTCTGCAAGAAACTGAAGATTGGCTATACGAAAATAGTGATGATGAATCTGATGAACATGACTATACTTTGGAAACTCGATGATCTCAAAAAGCTGCTACAAGTGTGTCTATGGTATCCACAAATGGTTGCACCACCACTGGGGTTATGTGGGCGGCCTGTCGACACAAGTCTTGATGAAGAACAATGA 1260 41.51 MALMNTQLLIQITIIGAILAVGSSNPNVQQGPQNWNFGFNYTNEPFRHPNPFQNSRRVIVGGSDNWRFGFNYTEWARTNAPFYFNDTLVEDTYVFLMKWIHDGYPAYNRRALYLIGIRNGLADDKSDTKGLIDYAWTNFLFADESREDFMGKLSLDFNKSHGCKLAIRSYVTDPCVLALGIKYALESMGLDVIEQWHMWLLPEIRNGLADEKSDIKGLIDYAWTNSLFANESSEEFMGKFSLDFNKSHGCRLAIQSLQNCVICHGFELVLFKRLSSKIFVSNNLEACRCRLSAVVQQQNQQQQQQMVPLQDSYMQIRAEALHNIESTIHDLGNIFTQLATMVSQQGDLAIRRMESLKVCKKLKIGYTKIVMMNLMNMTILWKLDDLKKLLQVCLWYPQMVAPPLGLCGRPVDTSLDEEQ 419
leaf

Annotation information

Select Seq ID Length Analysis Description Start End IPR GO
Cind3g04280 419 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 311 348 IPR000727 -
Cind3g04280 419 Gene3D - 281 352 - -
Cind3g04280 419 SUPERFAMILY t-snare proteins 295 348 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Cind3g04280 419 PANTHER GLYCINE-RICH PROTEIN-LIKE 49 89 - -
leaf

Pathway information

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cind3g04280 - -
leaf

Duplication type information

Select Gene1 Location1 Gene2 Location2 Duplicated-type
Cind Cind-Chr3:365935099 Cind3g04280 Cind-Chr3:366039577 proximal
leaf

Gene Family Members

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cind1g01001 ACH 5 67 SNARE and Associated Proteins family AT1G28490 29.231 3.29e-06 45.8
Cind1g01319 . 1 310 SNARE and Associated Proteins family AT1G51740 71.384 1.11e-148 418.0
Cind1g01335 . 3 314 SNARE and Associated Proteins family AT5G05760 59.271 2.14e-103 326.0
Cind1g01397 . 1 302 SNARE and Associated Proteins family AT2G18260 57.419 1.36e-109 324.0
Cind1g01989 . 1 306 SNARE and Associated Proteins family AT3G03800 66.34 8.06e-141 397.0
Cind1g02167 . 1 266 SNARE and Associated Proteins family AT3G09740 75.655 4.05e-152 423.0
Cind1g04496 . 1 287 SNARE and Associated Proteins family AT5G26980 72.414 3.15e-148 416.0
Cind1g06930 . 1 256 SNARE and Associated Proteins family AT5G46860 75.285 1.71e-141 397.0
Cind1g06345 . 1 162 SNARE and Associated Proteins family AT1G16240 65.432 2.10e-69 207.0
Cind1g06347 ACH 1 232 SNARE and Associated Proteins family AT1G16240 69.528 6.08e-120 339.0
Cind1g07109 ACH 1 256 SNARE and Associated Proteins family AT5G46860 73.384 4.44e-138 388.0
Cind1g07110 . 92 156 SNARE and Associated Proteins family AT3G09740 47.761 1.67e-12 60.1
Cind2g00435 . 200 296 SNARE and Associated Proteins family AT1G61290 48.454 1.32e-28 104.0
Cind2g00436 . 1 288 SNARE and Associated Proteins family AT3G11820 71.875 2.58e-138 394.0
Cind2g00575 ACH 1 306 SNARE and Associated Proteins family AT3G03800 60.841 2.62e-125 358.0
Cind2g00613 . 92 149 SNARE and Associated Proteins family AT3G09740 50.0 6.92e-13 60.8
Cind2g01043 . 70 200 SNARE and Associated Proteins family AT5G05760 65.649 2.45e-44 149.0
Cind2g01499 ACH 1 233 SNARE and Associated Proteins family AT1G79590 69.528 2.07e-120 341.0
Cind2g03083 . 1 293 SNARE and Associated Proteins family AT1G61290 67.893 3.26e-147 414.0
Cind2g04057 . 118 237 SNARE and Associated Proteins family AT3G09740 31.405 1.52e-06 46.6
Cind3g00831 . 19 69 SNARE and Associated Proteins family AT1G28490 49.057 3.14e-11 56.2
Cind3g01451 . 115 232 SNARE and Associated Proteins family AT1G16240 68.644 3.99e-58 183.0
Cind3g04280 . 250 295 SNARE and Associated Proteins family AT3G24350 80.435 6.16e-18 82.8
Cind3g04288 . 1 147 SNARE and Associated Proteins family AT1G32270 35.762 1.74e-22 96.7
Cind3g05334 . 186 286 SNARE and Associated Proteins family AT2G18260 63.81 3.75e-38 127.0
Cind3g05335 . 1 90 SNARE and Associated Proteins family AT2G18260 61.538 1.05e-27 106.0
Cind3g05522 . 77 106 SNARE and Associated Proteins family AT3G03800 70.0 4.98e-07 44.7
Cind4g01225 ACH 1 245 SNARE and Associated Proteins family AT1G28490 64.898 5.69e-118 335.0
Cind5g02344 . 25 288 SNARE and Associated Proteins family AT3G11820 67.803 2.15e-130 372.0
Cind5g02372 ACH 1 144 SNARE and Associated Proteins family AT1G32270 33.103 4.21e-20 86.7
Cind5g02474 . 1 266 SNARE and Associated Proteins family AT3G09740 63.534 1.56e-124 353.0
Cind5g02681 ACH 1 306 SNARE and Associated Proteins family AT3G03800 74.026 2.86e-156 437.0
Cind5g03611 . 8 60 SNARE and Associated Proteins family AT1G28490 51.852 5.45e-07 48.1
Cind5g03929 . 1 93 SNARE and Associated Proteins family AT5G46860 42.553 3.86e-12 59.7
Cind5g04792 ACH 1 286 SNARE and Associated Proteins family AT1G08560 68.836 5.83e-141 398.0
Cind5g05403 . 1 216 SNARE and Associated Proteins family AT3G09740 56.818 2.06e-83 250.0
Cind6g04102 . 32 129 SNARE and Associated Proteins family AT1G32270 34.653 1.30e-09 57.0
Cind7g02944 ACH 1 156 SNARE and Associated Proteins family AT1G32270 37.5 3.27e-25 100.0
Cind7g02945 . 1 156 SNARE and Associated Proteins family AT1G32270 35.0 2.61e-25 100.0
Cind7g03175 ACH 21 288 SNARE and Associated Proteins family AT3G11820 66.171 1.17e-126 363.0
Cind7g03571 ACH 2 245 SNARE and Associated Proteins family AT1G28490 69.262 7.57e-122 345.0
Cind8g00641 . 82 167 SNARE and Associated Proteins family AT3G24350 68.966 2.28e-30 110.0
Cind8g01228 . 157 209 SNARE and Associated Proteins family AT1G28490 73.585 1.08e-20 85.5
Cind8g03005 . 1 299 SNARE and Associated Proteins family AT1G61290 69.079 2.88e-145 409.0
Cind8g02892 . 238 296 SNARE and Associated Proteins family AT3G05710 72.881 4.64e-22 89.0
Cind8g03225 . 1 330 SNARE and Associated Proteins family AT3G05710 62.462 9.28e-143 403.0
Cind8g03867 . 19 97 SNARE and Associated Proteins family AT1G28490 59.494 2.68e-29 102.0
Cind9g00347 . 149 188 SNARE and Associated Proteins family AT3G45280 65.0 5.32e-11 57.4
Cind9g01020 . 160 296 SNARE and Associated Proteins family AT1G61290 62.774 1.38e-61 194.0
Cind9g01224 . 224 260 SNARE and Associated Proteins family AT5G16830 56.757 5.53e-08 48.1
Cind9g01632 ACH 1 243 SNARE and Associated Proteins family AT5G46860 72.581 7.76e-124 351.0
Cind9g04040 . 149 179 SNARE and Associated Proteins family AT3G45280 64.516 2.57e-06 48.1