AGRP Logo

AGRP

Asteraceae Genomic Research Platform

Gene Search

Example:
Example:

Gene details

leaf

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Fro14g01249 ATGTCGAACGCCGTCGTGAACGGCCTCGCCGGCGCCGGCGGAGGTATAATCGCTCAAATCATCACATATCCTCTTCAATCGGTCAACACGCGCCAACAGACGGAGAGAATCGCAAAGAAGTCAAAGTCTCAGGGATCATCTGGCGGTACACTTGTTCAATTACTTGAGGTTATACGAAGCGAAGGGATTGGTGGATTGTACAGCGGTCTTAAGCCATCGCTGCTTGGAACTGCTGCATCACAGGGGATTTATTATTATTTTTACCAGGTGTTTAAGAATAGAGCTGAAGCAATTGCAGCTGCTAATAAAAAAAAGGGTCGTGGAGATGGTACAGTTGGTATGTTCTCCTGGCTTGTTGTGGCTGCTTTAGCTGGGTCACTGAATGTACTGTTTACAAACCCGATATGGGTGCTTGTGACACGCATGCAGACACACACTCAAGCAGAACAGAAGATACTAGAAGCGAAGAAGGAAGCTCTGCTAAGAGAATGTTCTGAAAGCAGTCTGACTGGTACTTCTTTGCATGATAAGTTGCGTGAACTCGAAGCAGTGAAGCCTAATCCTTATGGGACATTGCATGCGGCATACGAGGTTTATAACGAAGCTGGAATAAAGGGATTTTGGAAAGGCATTGTTCCTACTTTAATCATGGTATGCAACCCGTCAATACAATTCATGATTTATGAGACATCTCTAAAGTACTTGAAGTCTAAACGTGCTGATAAGAAGCAAAGTGCAAATAAAGTTTCTGCTCTGGAGGTATTTGTAGTAGGTGCCATTGCTAAACTTGGAGCAACTGTGACAACATACCCTTTGTTAGTTGTAAAGTCAAGACTTCAAGCAAAGCAAGAAATCAGTACAAACAATTCTTTGAGATATTCAGGTACCGTGGATGCAATTGTGAAGATGATTCAGTATGAAGGATTATCAAGCTTCTACAAAGGTATGAGCACCAAGATAGTACAGAGTGTATTTGCAGCCTCTGTACTTTTCATGATCAAGGAGGAGCTGGTTAAGTTTTATGGAATGTTAGCGAAGAAGAGCCAAAGGATATTATTAAAATTGTCAAATTAG 1074 42.36 MSNAVVNGLAGAGGGIIAQIITYPLQSVNTRQQTERIAKKSKSQGSSGGTLVQLLEVIRSEGIGGLYSGLKPSLLGTAASQGIYYYFYQVFKNRAEAIAAANKKKGRGDGTVGMFSWLVVAALAGSLNVLFTNPIWVLVTRMQTHTQAEQKILEAKKEALLRECSESSLTGTSLHDKLRELEAVKPNPYGTLHAAYEVYNEAGIKGFWKGIVPTLIMVCNPSIQFMIYETSLKYLKSKRADKKQSANKVSALEVFVVGAIAKLGATVTTYPLLVVKSRLQAKQEISTNNSLRYSGTVDAIVKMIQYEGLSSFYKGMSTKIVQSVFAASVLFMIKEELVKFYGMLAKKSQRILLKLSN 357
leaf

Annotation information

Select Seq ID Length Analysis Description Start End IPR GO
Fro14g01249 357 PANTHER MITOCHONDRIAL NICOTINAMIDE ADENINE DINUCLEOTIDE TRANSPORTER 1-RELATED-RELATED 3 352 IPR044712 GO:0006862(InterPro)|GO:0022857(PANTHER)|GO:0055085(InterPro)|GO:0055085(PANTHER)
Fro14g01249 357 ProSiteProfiles Solute carrier (Solcar) repeat profile. 2 94 IPR018108 -
Fro14g01249 357 Pfam Mitochondrial carrier protein 115 238 IPR018108 -
Fro14g01249 357 Pfam Mitochondrial carrier protein 249 341 IPR018108 -
Fro14g01249 357 Pfam Mitochondrial carrier protein 4 93 IPR018108 -
Fro14g01249 357 Gene3D Mitochondrial carrier domain 4 351 IPR023395 -
Fro14g01249 357 ProSiteProfiles Solute carrier (Solcar) repeat profile. 249 340 IPR018108 -
Fro14g01249 357 SUPERFAMILY Mitochondrial carrier 3 336 IPR023395 -
Fro14g01249 357 ProSiteProfiles Solute carrier (Solcar) repeat profile. 112 234 IPR018108 -
leaf

Pathway information

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Fro14g01249 K13354 solute carrier family 25 (peroxisomal adenine nucleotide transporter), member 17
leaf

Duplication type information

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
2522705 Fro Fro14g01249 Fro-Chr14:20054167 Fro5g01162 Fro-Chr5:18122633
2543111 Fro Fro14g01249 Fro-Chr14:20054167 Fro15g01388 Fro-Chr15:28802095
leaf

Gene Family Members

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Fro1g00295 . 1 300 Chloroplast and Mitochondria gene family AT4G25700 65.723 9.96e-143 403.0
Fro1g00610 ACH 1 307 Chloroplast and Mitochondria gene family AT5G40810 85.993 0.0 513.0
Fro1g00906 WGDA 2 280 Chloroplast and Mitochondria gene family AT4G10340 83.333 1.25e-154 431.0
Fro1g01257 . 31 307 Chloroplast and Mitochondria gene family AT5G40810 88.489 7.65e-173 480.0
Fro2g00419 WGDA 4 580 Chloroplast and Mitochondria gene family AT4G21490 66.897 0.0 809.0
Fro2g00540 . 33 254 Chloroplast and Mitochondria gene family AT3G61470 91.892 5.83e-151 420.0
Fro2g01374 . 2 264 Chloroplast and Mitochondria gene family AT2G05070 66.914 3.21e-122 347.0
Fro3g00285 . 12 327 Chloroplast and Mitochondria gene family AT1G25380 64.174 4.72e-140 399.0
Fro3g00555 . 1 239 Chloroplast and Mitochondria gene family AT3G54890 84.167 8.33e-146 405.0
Fro3g00786 . 41 271 Chloroplast and Mitochondria gene family AT4G03320 36.885 7.96e-44 148.0
Fro3g00954 . 1 258 Chloroplast and Mitochondria gene family AT1G15820 81.923 1.34e-151 421.0
Fro3g01287 . 4 157 Chloroplast and Mitochondria gene family AT1G72750 60.39 2.58e-62 189.0
Fro3g01309 . 4 188 Chloroplast and Mitochondria gene family AT1G72750 63.243 1.54e-70 210.0
Fro3g01412 WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 68.406 1.74e-167 469.0
Fro3g01442 . 1 85 Chloroplast and Mitochondria gene family AT1G72820 63.529 3.92e-35 120.0
Fro3g01443 . 99 343 Chloroplast and Mitochondria gene family AT1G72820 67.206 8.93e-110 318.0
Fro4g00325 WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 70.725 1.33e-169 474.0
Fro4g00843 . 2 258 Chloroplast and Mitochondria gene family AT1G15820 80.769 1.19e-149 416.0
Fro4g01084 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.64 1.30e-168 465.0
Fro5g00397 WGDA 33 294 Chloroplast and Mitochondria gene family AT1G25380 29.577 8.67e-12 63.5
Fro5g00527 WGDA 29 300 Chloroplast and Mitochondria gene family AT2G47490 37.544 9.17e-49 163.0
Fro5g00765 ACH,WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 84.516 0.0 506.0
Fro5g00783 ACH,WGDA 5 373 Chloroplast and Mitochondria gene family AT5G14040 76.694 0.0 580.0
Fro5g01162 . 33 294 Chloroplast and Mitochondria gene family AT2G47490 28.231 2.21e-27 107.0
Fro6g00289 . 51 257 Chloroplast and Mitochondria gene family AT3G61470 66.667 3.07e-101 294.0
Fro6g00533 . 12 316 Chloroplast and Mitochondria gene family AT1G07030 29.967 4.78e-33 127.0
Fro6g00912 WGDA 55 255 Chloroplast and Mitochondria gene family AT3G61470 56.219 4.34e-76 229.0
Fro6g01058 . 2 265 Chloroplast and Mitochondria gene family AT2G05100 67.416 6.88e-122 347.0
Fro6g01187 . 41 316 Chloroplast and Mitochondria gene family AT1G07030 33.453 1.34e-34 126.0
Fro7g00803 WGDA 1 265 Chloroplast and Mitochondria gene family AT2G05100 89.434 6.02e-180 493.0
Fro8g00019 ACH 11 236 Chloroplast and Mitochondria gene family AT1G26100 62.447 1.46e-88 260.0
Fro8g00452 . 33 254 Chloroplast and Mitochondria gene family AT3G61470 90.541 7.42e-150 417.0
Fro8g00775 . 84 345 Chloroplast and Mitochondria gene family AT2G28800 20.495 5.78e-07 50.1
Fro8g01187 ACH 1 228 Chloroplast and Mitochondria gene family AT5G38630 65.789 1.68e-108 310.0
Fro9g01228 WGDA 1 265 Chloroplast and Mitochondria gene family AT2G05070 88.302 2.92e-179 491.0
Fro10g00992 WGDA 4 208 Chloroplast and Mitochondria gene family AT4G25570 43.902 1.96e-54 172.0
Fro11g00042 . 1 345 Chloroplast and Mitochondria gene family AT1G72820 68.195 5.68e-174 485.0
Fro11g00259 ACH 1 361 Chloroplast and Mitochondria gene family AT5G14040 69.972 1.07e-180 504.0
Fro11g00634 . 37 254 Chloroplast and Mitochondria gene family AT3G61470 46.154 2.85e-60 190.0
Fro11g00701 WGDA 2 280 Chloroplast and Mitochondria gene family AT4G10340 83.392 1.07e-154 431.0
Fro11g01069 . 7 320 Chloroplast and Mitochondria gene family AT5G15640 72.293 1.90e-175 487.0
Fro11g01478 . 1 303 Chloroplast and Mitochondria gene family AT2G17270 67.987 1.39e-162 453.0
Fro11g01639 ACH 2 373 Chloroplast and Mitochondria gene family AT5G14040 76.344 0.0 566.0
Fro11g02271 WGDA 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.94 9.30e-170 468.0
Fro11g02272 WGDA 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.94 2.26e-169 467.0
Fro12g00349 WGDA 1 267 Chloroplast and Mitochondria gene family AT1G29930 88.06 2.23e-172 474.0
Fro12g00350 ACH,WGDA 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.313 3.07e-172 474.0
Fro12g00899 . 197 257 Chloroplast and Mitochondria gene family AT3G61470 67.213 1.68e-23 87.8
Fro12g00900 . 51 175 Chloroplast and Mitochondria gene family AT3G61470 66.4 4.80e-60 186.0
Fro12g01251 . 65 548 Chloroplast and Mitochondria gene family AT2G18710 84.504 0.0 827.0
Fro12g01530 . 1 72 Chloroplast and Mitochondria gene family AT5G05370 66.667 4.73e-34 109.0
Fro12g01541 . 1 346 Chloroplast and Mitochondria gene family AT1G72820 62.717 3.96e-147 417.0
Fro12g01722 . 7 143 Chloroplast and Mitochondria gene family AT1G07020 42.177 2.07e-23 88.2
Fro12g02408 . 18 273 Chloroplast and Mitochondria gene family AT1G61520 89.453 1.65e-170 470.0
Fro12g02503 . 18 273 Chloroplast and Mitochondria gene family AT1G61520 89.453 1.65e-170 470.0
Fro13g00342 WGDA 13 224 Chloroplast and Mitochondria gene family AT5G38630 41.981 1.08e-56 178.0
Fro13g00381 . 4 211 Chloroplast and Mitochondria gene family AT4G25570 39.904 5.38e-57 179.0
Fro13g00455 ACH 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.517 4.01e-171 471.0
Fro13g01158 . 15 287 Chloroplast and Mitochondria gene family AT5G01530 82.784 3.22e-160 446.0
Fro13g01207 . 1 72 Chloroplast and Mitochondria gene family AT5G05370 61.111 1.91e-31 102.0
Fro13g01222 WGDA 1 325 Chloroplast and Mitochondria gene family AT2G30160 71.037 6.31e-164 458.0
Fro14g00860 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.266 1.73e-170 469.0
Fro14g01249 . 37 306 Chloroplast and Mitochondria gene family AT1G25380 26.087 6.69e-31 118.0
Fro14g01266 . 1 307 Chloroplast and Mitochondria gene family AT2G47490 76.623 4.88e-166 462.0
Fro14g01612 WGDA 1 327 Chloroplast and Mitochondria gene family AT2G30160 71.646 1.27e-168 470.0
Fro14g01690 . 51 405 Chloroplast and Mitochondria gene family AT2G28800 81.667 0.0 592.0
Fro15g00007 . 42 327 Chloroplast and Mitochondria gene family AT1G76570 79.021 2.00e-177 491.0
Fro15g01176 WGDA 33 294 Chloroplast and Mitochondria gene family AT1G25380 28.873 3.96e-13 67.4
Fro15g01388 WGDA 29 300 Chloroplast and Mitochondria gene family AT2G47490 37.895 1.25e-48 163.0
Fro15g01542 ACH 1 228 Chloroplast and Mitochondria gene family AT5G38630 68.421 1.06e-114 325.0
Fro15g01688 ACH,WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 84.839 0.0 507.0
Fro15g01725 ACH,WGDA 2 373 Chloroplast and Mitochondria gene family AT5G14040 76.882 0.0 575.0
Fro15g02402 . 1 239 Chloroplast and Mitochondria gene family AT4G25570 65.69 1.43e-112 320.0
Fro16g00299 . 70 354 Chloroplast and Mitochondria gene family AT5G54290 80.0 2.34e-145 413.0
Fro16g00361 ACH 1 367 Chloroplast and Mitochondria gene family AT5G14040 70.027 0.0 538.0
Fro16g00428 ACH 1 367 Chloroplast and Mitochondria gene family AT5G14040 70.027 0.0 538.0
Fro16g00723 WGDA 55 255 Chloroplast and Mitochondria gene family AT3G61470 56.716 4.86e-77 232.0
Fro17g01546 ACH 72 364 Chloroplast and Mitochondria gene family AT5G14040 85.666 0.0 527.0
Fro17g01693 . 1 364 Chloroplast and Mitochondria gene family AT5G14040 75.275 0.0 551.0
Fro18g00019 . 14 287 Chloroplast and Mitochondria gene family AT5G01530 82.847 7.13e-162 449.0
Fro18g01396 . 76 407 Chloroplast and Mitochondria gene family AT2G28800 62.89 9.61e-152 439.0
Fro18g01724 . 18 224 Chloroplast and Mitochondria gene family AT1G14730 43.961 1.43e-59 185.0
Fro18g01725 . 1 224 Chloroplast and Mitochondria gene family AT1G14730 60.268 2.67e-92 268.0
Fro10000366.1g00006 . 1 224 Chloroplast and Mitochondria gene family AT1G14730 60.268 2.67e-92 268.0
Fro10000310.1g00007 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 56.716 4.86e-77 232.0