AGRP Logo

AGRP

Asteraceae Genomic Research Platform

Gene Search

Example:
Example:

Gene details

leaf

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Fso2g00427 ATGAAGAAACCCAAATCCAAGCAATTTCGCTTACAGAGCCGCAATTCCGAGCTTCAAGAAATTGAATTACTCGAGAAATGGATCGAATTCGGGAAACCCGAATCGGGATCCAACCCGTTGTCTCTTCCGCCGCTGCCGGCGAAATCTCCGGTCGGCCGTATCGATGAGAACACTTACTCGCAATATGCCGGCTGCACGAAGTTCCAGCAGCTTCCGATTTCGAAGAATTTGAAGGATGGGTTGCGACAATCGGGTTATAAGAACATGACGAATATTCAGAGGGCTTCGTTGCCTCATTCGCTTTGTGGCCGTGATATACTCGGTGCGGCGAAAACCGGGTCCGGAAAAACCCTAGCTTTTATCATTCCAGTGTTGGAGAAATTATACAAAGCTAGATGGGGTCTAGAGGATGGAGTGGGTAGCATCATCATGTCTCCAACTAGGGAGTTAGCAGACCAGCTTTTTGGCGTACTGAAGTCGGTTGGAAAGCACCATGGATTTAGTGCTGGTCTTTTAATTGGTGGGCATGAATATGATGAAGAGAAGGATCATGTAAATCGGATGAATATATTGATTTGTACACCTGGACGGCTTCTCAAGCACATGGACACAACTCCAAATTTTGATTGTTCACAACTACAGGTTTTGGTACTTGATGAAGCTGACCGAATTCTTGATGCTGGTTTTAAAAAAGAAGTAAATGCCATAATTTCACAACTTCCAAAACATAGGCAGACTTTACTTTTCTCTGCAACACAAACAAAATCAGTCAAAGATCTTGCAAGACTTAGTCTTAAAGACCCTGAATATATTGCTGTTGATGAAGAATCTATAGCTGCTACGCCAAATCGTCTGCAACAAAAAGCCATACTTGTTCCCCTAGACCAAAAGCTAGACATGCTGTGGAGTTTCATAAAAGCGCATTTACATTCAAGAATTCTTGTTTTTCTTTCTAGCTGCAAGCAGGTGAGGTTTGTATATGAAGCATTCAAGAAACTGCGACCTGGGATCCCTTTAAAATGCTTGCATGGAAGGATGAAACAAGTAAAAAGAATGTTCATATTGCAACAATTTGTTGAACAAAGATCTGTTCTTCTTTCAACTGATGTGTCTTCAAGGGGGCTGGATTTCAACAAGGGAGTTGATTGGGTTGTTCAGGTCGATTGCCCTGATGATGTGGCAAGTTACATACATAGAGTTGGCCGCACAGCCCGTTATGATTCTATGGGGCGGTCTGTCTTGTTCCTCTTACCTTCTGAGATGAAAATGCTTGAGAGATTACAAGAGAAAAAGATACCCATTCAGTTTGACAAGCCGAACACAAAACGATTACAATCTGTTTCCGGTTTATTAGCTGCTCTGCTGGCCAAGTACACAGACCTACAGCCTTTGGCCCAACGGGCGTTTAAAACATATTTGAAATCGATTTTCAAACAAAAAGATAAAGAAATTTTCGATGTGACAAAGCTTCCCATTGATGAATATTCAGCTTCATTGGGTCTGCCTATGACCCCACAACTCCGTTACCTCAACCGCAAAAGTACTGACAAAAGTACCCCTGAAGAATCCATTTTGGTTCCCCAAATTCCTGCAAAGAAAGATTTGATAAGACCAAAGTCAAGTAACAATTTACTTGAGGAATCAGAAGATGAAGAGCTGCTCGATGTACTTCACAGCAAGGAAACTACAGATGGTGATGATGGGAAAGCAATTGCAGCTGACAATATTTTGCCTTCAACTAGGATTCTTAAGAAAAAGAAGCTGAAAATTAATGTTCATAGGCCCGTGGGTACCCGTGTTGTATTTGATGAAGAAGGCAACACACTGCCACCACTTGCAAGATTAGCTGGCATCGGCGCCGCCAACACTTCTCTCCTTGATAAATCTAAAGTAATGGAGAGGTTTGCAGAATTGAGAGAAGAAATGAAAACACGCGATCAAGAGGACAAACTCCTTGACCGTAAAAGACGTAAAGAAAAAAGAATAAAGGAGAAAGAGAAACACAAGAGAGCAAGAAACGAAGAAGACGACGGCGATGATGACTTTTCTGGGTCAGATAAAGACCTTAATAAAGTCAAAAGATCAAAGGTGTACTTTGACAGTGATGATAGTGATGGTGAAATGAAAGATAAGGTTGCATTGAAGACTGATGAAATCTCTTTAGCAGAACAAGAAGAACTTGCCCTTAAGTTGTTGAGTTCTATGCACTCATGA 2214 41.73 MKKPKSKQFRLQSRNSELQEIELLEKWIEFGKPESGSNPLSLPPLPAKSPVGRIDENTYSQYAGCTKFQQLPISKNLKDGLRQSGYKNMTNIQRASLPHSLCGRDILGAAKTGSGKTLAFIIPVLEKLYKARWGLEDGVGSIIMSPTRELADQLFGVLKSVGKHHGFSAGLLIGGHEYDEEKDHVNRMNILICTPGRLLKHMDTTPNFDCSQLQVLVLDEADRILDAGFKKEVNAIISQLPKHRQTLLFSATQTKSVKDLARLSLKDPEYIAVDEESIAATPNRLQQKAILVPLDQKLDMLWSFIKAHLHSRILVFLSSCKQVRFVYEAFKKLRPGIPLKCLHGRMKQVKRMFILQQFVEQRSVLLSTDVSSRGLDFNKGVDWVVQVDCPDDVASYIHRVGRTARYDSMGRSVLFLLPSEMKMLERLQEKKIPIQFDKPNTKRLQSVSGLLAALLAKYTDLQPLAQRAFKTYLKSIFKQKDKEIFDVTKLPIDEYSASLGLPMTPQLRYLNRKSTDKSTPEESILVPQIPAKKDLIRPKSSNNLLEESEDEELLDVLHSKETTDGDDGKAIAADNILPSTRILKKKKLKINVHRPVGTRVVFDEEGNTLPPLARLAGIGAANTSLLDKSKVMERFAELREEMKTRDQEDKLLDRKRRKEKRIKEKEKHKRARNEEDDGDDDFSGSDKDLNKVKRSKVYFDSDDSDGEMKDKVALKTDEISLAEQEELALKLLSSMHS 737
leaf

Annotation information

Select Seq ID Length Analysis Description Start End IPR GO
Fso2g00427 737 SMART DUF4217-3 446 509 IPR025313 -
Fso2g00427 737 SUPERFAMILY P-loop containing nucleoside triphosphate hydrolases 211 423 IPR027417 -
Fso2g00427 737 Coils Coil 648 675 - -
Fso2g00427 737 SMART helicmild6 324 407 IPR001650 -
Fso2g00427 737 ProSitePatterns DEAD-box subfamily ATP-dependent helicases signature. 217 225 IPR000629 -
Fso2g00427 737 ProSiteProfiles Superfamilies 1 and 2 helicase ATP-binding type-1 domain profile. 97 271 IPR014001 -
Fso2g00427 737 Gene3D - 283 521 IPR027417 -
Fso2g00427 737 ProSiteProfiles DEAD-box RNA helicase Q motif profile. 66 94 IPR014014 GO:0003724(InterPro)
Fso2g00427 737 Pfam Helicase conserved C-terminal domain 297 406 IPR001650 -
Fso2g00427 737 CDD SF2-C-DEAD 285 416 - -
Fso2g00427 737 CDD DEADc-DDX10 78 273 - -
Fso2g00427 737 Gene3D - 52 277 IPR027417 -
Fso2g00427 737 ProSiteProfiles Superfamilies 1 and 2 helicase C-terminal domain profile. 293 445 IPR001650 -
Fso2g00427 737 PANTHER RNA HELICASE 67 667 - GO:0005634(PANTHER)|GO:0006364(PANTHER)
Fso2g00427 737 SUPERFAMILY P-loop containing nucleoside triphosphate hydrolases 59 273 IPR027417 -
Fso2g00427 737 Pfam DEAD-DEAH box helicase 90 260 IPR011545 GO:0003676(InterPro)|GO:0005524(InterPro)
Fso2g00427 737 MobiDBLite consensus disorder prediction 660 688 - -
Fso2g00427 737 SMART ultradead3 85 288 IPR014001 -
Fso2g00427 737 Pfam Domain of unknown function (DUF4217) 460 506 IPR025313 -
leaf

Pathway information

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Fso2g00427 K14776 ATP-dependent RNA helicase DDX10/DBP4 [EC:5.6.2.7]
leaf

Duplication type information

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
2604126 Fso Fso18g02204 Fso-Chr18:69170845 Fso2g00427 Fso-Chr2:5769352
2607238 Fso Fso2g00427 Fso-Chr2:5769352 Fso7g00493 Fso-Chr7:6142016
2628574 Fso Fso2g00427 Fso-Chr2:5769352 Fso8g01261 Fso-Chr8:34512042
leaf

Gene Family Members

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Fso1g00042 . 252 422 Eukaryotic Initiation Factors gene family AT5G11170 27.072 5.90e-07 52.4
Fso1g00145 ACH 1 228 Eukaryotic Initiation Factors gene family AT5G12110 73.362 3.66e-105 301.0
Fso1g00176 WGDA 20 406 Eukaryotic Initiation Factors gene family AT3G19760 34.053 2.48e-67 220.0
Fso1g00210 ACH 136 308 Eukaryotic Initiation Factors gene family AT2G23350 32.24 2.25e-22 94.7
Fso1g00317 . 33 401 Eukaryotic Initiation Factors gene family AT3G19760 31.538 1.28e-58 200.0
Fso1g00379 . 83 1048 Eukaryotic Initiation Factors gene family AT1G48410 53.267 0.0 1015.0
Fso1g00456 . 133 408 Eukaryotic Initiation Factors gene family AT2G23350 26.132 1.13e-24 105.0
Fso1g00479 WGDA 215 324 Eukaryotic Initiation Factors gene family AT4G34110 26.271 8.36e-09 54.3
Fso1g00645 . 1 465 Eukaryotic Initiation Factors gene family AT1G04170 88.817 0.0 867.0
Fso1g00732 . 100 351 Eukaryotic Initiation Factors gene family AT3G16380 24.809 7.85e-15 76.3
Fso1g00782 . 1 712 Eukaryotic Initiation Factors gene family AT5G27640 72.969 0.0 1102.0
Fso1g01669 . 1 113 Eukaryotic Initiation Factors gene family AT4G27130 87.611 1.03e-73 212.0
Fso1g01684 . 133 418 Eukaryotic Initiation Factors gene family AT2G23350 25.839 2.63e-25 106.0
Fso1g01788 . 121 379 Eukaryotic Initiation Factors gene family AT1G34140 28.731 3.60e-16 78.6
Fso1g02106 . 37 227 Eukaryotic Initiation Factors gene family AT4G34110 25.118 2.21e-07 50.1
Fso1g02164 ACH 211 419 Eukaryotic Initiation Factors gene family AT1G49760 27.57 3.30e-13 69.3
Fso1g02207 WGDA 3 429 Eukaryotic Initiation Factors gene family AT5G60390 30.664 1.43e-46 165.0
Fso1g02491 ACH 7 268 Eukaryotic Initiation Factors gene family AT5G20920 71.756 1.45e-126 358.0
Fso2g00043 . 4 629 Eukaryotic Initiation Factors gene family AT4G34110 69.008 0.0 887.0
Fso2g00086 . 228 292 Eukaryotic Initiation Factors gene family AT3G11400 35.385 3.23e-08 54.3
Fso2g00162 . 711 1145 Eukaryotic Initiation Factors gene family AT1G76810 28.294 3.76e-26 111.0
Fso2g00236 . 143 305 Eukaryotic Initiation Factors gene family AT1G71770 30.0 2.68e-11 62.8
Fso2g00426 . 133 458 Eukaryotic Initiation Factors gene family AT2G23350 26.706 4.38e-26 109.0
Fso2g00427 . 35 391 Eukaryotic Initiation Factors gene family AT3G19760 26.703 5.45e-36 139.0
Fso2g00479 ACH 1 843 Eukaryotic Initiation Factors gene family AT1G56070 92.171 0.0 1646.0
Fso2g00480 . 1 843 Eukaryotic Initiation Factors gene family AT1G56070 92.408 0.0 1648.0
Fso2g00592 . 135 449 Eukaryotic Initiation Factors gene family AT1G49760 21.981 3.51e-13 71.2
Fso2g00714 . 215 346 Eukaryotic Initiation Factors gene family AT2G46290 31.618 8.52e-07 50.1
Fso2g00865 . 279 412 Eukaryotic Initiation Factors gene family AT1G72730 37.063 3.25e-19 83.6
Fso2g01015 . 98 988 Eukaryotic Initiation Factors gene family AT5G43810 81.544 0.0 1544.0
Fso2g01245 . 36 389 Eukaryotic Initiation Factors gene family AT3G19760 26.509 1.11e-26 110.0
Fso2g01741 . 118 988 Eukaryotic Initiation Factors gene family AT5G43810 70.838 0.0 1335.0
Fso2g02279 . 327 402 Eukaryotic Initiation Factors gene family AT2G23350 34.211 1.66e-08 52.8
Fso2g02283 . 210 286 Eukaryotic Initiation Factors gene family AT5G06000 42.857 3.49e-13 61.2
Fso2g02456 ACH,WGDA 125 404 Eukaryotic Initiation Factors gene family AT1G49760 27.667 4.74e-26 108.0
Fso2g02480 . 1 412 Eukaryotic Initiation Factors gene family AT3G13920 92.029 0.0 787.0
Fso2g02637 . 1 194 Eukaryotic Initiation Factors gene family AT1G53880 29.412 2.22e-18 80.9
Fso2g02638 . 32 189 Eukaryotic Initiation Factors gene family AT1G53880 28.571 1.21e-15 73.2
Fso2g02639 . 32 189 Eukaryotic Initiation Factors gene family AT1G53880 28.743 5.81e-14 68.2
Fso2g02686 ACH 212 464 Eukaryotic Initiation Factors gene family AT1G49760 26.255 1.28e-14 73.9
Fso2g02742 . 33 378 Eukaryotic Initiation Factors gene family AT3G19760 31.742 1.48e-59 205.0
Fso2g02864 ACH 45 234 Eukaryotic Initiation Factors gene family AT4G18040 72.632 1.77e-108 309.0
Fso2g02949 ACH 56 207 Eukaryotic Initiation Factors gene family AT1G71770 25.806 1.30e-09 60.1
Fso2g02968 WGDA 1 145 Eukaryotic Initiation Factors gene family AT2G04520 90.411 7.58e-88 251.0
Fso2g03117 . 35 401 Eukaryotic Initiation Factors gene family AT3G19760 37.602 1.22e-91 283.0
Fso2g03156 . 8 139 Eukaryotic Initiation Factors gene family AT3G22980 37.778 9.72e-20 92.8
Fso3g00044 . 201 381 Eukaryotic Initiation Factors gene family AT2G36660 25.683 2.74e-14 71.2
Fso3g00077 WGDA 4 432 Eukaryotic Initiation Factors gene family AT3G26618 91.628 0.0 823.0
Fso3g00097 . 32 391 Eukaryotic Initiation Factors gene family AT3G19760 28.866 5.60e-42 155.0
Fso3g00159 . 40 404 Eukaryotic Initiation Factors gene family AT3G13920 33.514 4.50e-59 198.0
Fso3g00161 . 36 126 Eukaryotic Initiation Factors gene family AT3G19760 31.868 1.08e-10 56.6
Fso3g00166 ACH 1 843 Eukaryotic Initiation Factors gene family AT1G56070 91.578 0.0 1628.0
Fso3g00212 WGDA 195 383 Eukaryotic Initiation Factors gene family AT2G36660 30.348 6.78e-16 78.6
Fso3g00274 . 227 393 Eukaryotic Initiation Factors gene family AT2G23350 31.818 1.42e-15 77.0
Fso3g00363 WGDA 200 385 Eukaryotic Initiation Factors gene family AT3G16380 37.766 1.70e-26 107.0
Fso3g00503 . 133 158 Eukaryotic Initiation Factors gene family AT1G13950 88.462 1.12e-09 50.1
Fso3g00504 ACH,WGDA 41 126 Eukaryotic Initiation Factors gene family AT1G13950 80.233 5.55e-46 143.0
Fso3g00580 . 1 642 Eukaryotic Initiation Factors gene family AT5G38640 54.94 0.0 667.0
Fso3g00870 . 28 353 Eukaryotic Initiation Factors gene family AT2G46290 84.049 0.0 575.0
Fso3g00871 . 44 126 Eukaryotic Initiation Factors gene family AT1G49760 30.952 1.09e-07 48.5
Fso3g01007 . 1 100 Eukaryotic Initiation Factors gene family AT5G54760 80.0 1.32e-55 167.0
Fso3g01347 . 27 427 Eukaryotic Initiation Factors gene family AT5G11170 95.012 0.0 793.0
Fso3g01900 WGDA 36 391 Eukaryotic Initiation Factors gene family AT3G19760 25.118 5.19e-42 154.0
Fso3g01903 ACH,WGDA 22 186 Eukaryotic Initiation Factors gene family AT1G53880 42.045 7.46e-36 130.0
Fso3g01969 . 13 189 Eukaryotic Initiation Factors gene family AT1G53880 27.174 2.33e-11 60.8
Fso3g02040 . 200 399 Eukaryotic Initiation Factors gene family AT4G34110 31.401 1.89e-22 94.7
Fso3g02047 . 176 423 Eukaryotic Initiation Factors gene family AT1G71770 26.493 1.31e-12 69.7
Fso3g02201 ACH 1 228 Eukaryotic Initiation Factors gene family AT5G12110 71.616 3.43e-104 298.0
Fso3g02214 ACH 215 292 Eukaryotic Initiation Factors gene family AT3G11400 28.205 5.48e-09 52.8
Fso3g02297 WGDA 126 297 Eukaryotic Initiation Factors gene family AT4G34110 37.158 9.13e-24 98.6
Fso3g02432 . 32 221 Eukaryotic Initiation Factors gene family AT5G18110 82.723 6.22e-120 339.0
Fso3g02437 . 215 340 Eukaryotic Initiation Factors gene family AT4G34110 29.921 7.56e-12 62.0
Fso3g02550 . 136 206 Eukaryotic Initiation Factors gene family AT2G23350 41.667 5.56e-13 63.2
Fso3g02615 . 304 392 Eukaryotic Initiation Factors gene family AT2G36660 33.333 4.72e-09 55.1
Fso3g02624 . 33 405 Eukaryotic Initiation Factors gene family AT3G19760 31.139 2.37e-61 207.0
Fso4g00270 . 1 435 Eukaryotic Initiation Factors gene family AT3G26618 89.45 0.0 820.0
Fso4g00275 WGDA 33 183 Eukaryotic Initiation Factors gene family AT1G34140 25.767 1.05e-10 60.5
Fso4g00300 WGDA 5 337 Eukaryotic Initiation Factors gene family AT2G40290 78.679 0.0 514.0
Fso4g00376 ACH,WGDA 21 194 Eukaryotic Initiation Factors gene family AT1G53880 38.462 1.20e-34 127.0
Fso4g00525 . 304 369 Eukaryotic Initiation Factors gene family AT3G16380 40.0 1.12e-06 50.4
Fso4g00570 . 16 250 Eukaryotic Initiation Factors gene family AT2G39990 28.226 1.16e-25 102.0
Fso4g00710 WGDA 20 257 Eukaryotic Initiation Factors gene family AT2G39990 23.106 3.25e-11 61.2
Fso4g00783 . 178 245 Eukaryotic Initiation Factors gene family AT5G20920 75.0 2.69e-31 109.0
Fso4g00806 WGDA 329 407 Eukaryotic Initiation Factors gene family AT2G23350 41.25 3.13e-13 63.9
Fso4g00902 WGDA 233 407 Eukaryotic Initiation Factors gene family AT1G71770 25.824 1.24e-13 70.5
Fso4g00928 WGDA 203 415 Eukaryotic Initiation Factors gene family AT2G36660 27.556 1.08e-13 71.6
Fso4g01926 . 5 412 Eukaryotic Initiation Factors gene family AT3G13920 91.22 0.0 769.0
Fso5g00041 . 36 428 Eukaryotic Initiation Factors gene family AT4G34110 43.392 5.44e-113 344.0
Fso5g00097 . 14 411 Eukaryotic Initiation Factors gene family AT3G13920 30.216 1.30e-55 191.0
Fso5g00267 . 180 295 Eukaryotic Initiation Factors gene family AT3G19760 34.483 5.69e-15 68.6
Fso5g00422 WGDA 554 670 Eukaryotic Initiation Factors gene family AT1G49760 68.333 3.79e-44 151.0
Fso5g00483 ACH 126 402 Eukaryotic Initiation Factors gene family AT4G34110 27.875 1.04e-27 114.0
Fso5g00634 . 5 319 Eukaryotic Initiation Factors gene family AT2G46280 21.098 5.39e-07 49.3
Fso5g01270 . 134 1294 Eukaryotic Initiation Factors gene family AT1G76810 64.041 0.0 1169.0
Fso5g01283 . 624 729 Eukaryotic Initiation Factors gene family AT5G57870 32.075 1.14e-09 59.7
Fso5g01712 . 9 138 Eukaryotic Initiation Factors gene family AT3G22980 43.846 6.10e-25 105.0
Fso5g01813 . 305 417 Eukaryotic Initiation Factors gene family AT2G36660 32.174 1.74e-09 57.0
Fso5g02090 . 227 393 Eukaryotic Initiation Factors gene family AT2G23350 28.409 7.30e-14 71.6
Fso5g02317 WGDA 1 189 Eukaryotic Initiation Factors gene family AT1G53880 32.663 2.40e-25 101.0
Fso6g00025 . 304 491 Eukaryotic Initiation Factors gene family AT3G16380 30.688 1.35e-12 68.6
Fso6g00245 . 217 398 Eukaryotic Initiation Factors gene family AT4G34110 32.967 7.67e-21 90.1
Fso6g00469 WGDA 28 196 Eukaryotic Initiation Factors gene family AT4G34110 29.787 1.31e-10 62.8
Fso6g00471 . 18 408 Eukaryotic Initiation Factors gene family AT3G19760 88.491 0.0 726.0
Fso6g00495 . 62 409 Eukaryotic Initiation Factors gene family AT3G13920 33.512 1.03e-62 205.0
Fso6g00611 ACH,WGDA 61 120 Eukaryotic Initiation Factors gene family AT1G71770 40.0 1.16e-06 46.2
Fso6g00753 . 1 412 Eukaryotic Initiation Factors gene family AT3G13920 92.029 0.0 788.0
Fso6g00767 ACH,WGDA 125 404 Eukaryotic Initiation Factors gene family AT1G49760 28.667 4.92e-26 108.0
Fso6g01592 . 222 381 Eukaryotic Initiation Factors gene family AT5G11170 28.395 3.62e-10 60.5
Fso6g01732 . 133 417 Eukaryotic Initiation Factors gene family AT2G23350 27.365 2.27e-27 112.0
Fso6g01749 . 1 113 Eukaryotic Initiation Factors gene family AT1G54290 87.611 5.32e-75 216.0
Fso6g01961 . 704 1145 Eukaryotic Initiation Factors gene family AT1G76810 27.193 1.47e-29 125.0
Fso7g00017 . 53 403 Eukaryotic Initiation Factors gene family AT3G19760 23.656 7.79e-12 66.6
Fso7g00026 . 67 401 Eukaryotic Initiation Factors gene family AT3G19760 33.431 6.11e-54 189.0
Fso7g00159 . 1 245 Eukaryotic Initiation Factors gene family AT3G55620 91.837 1.91e-173 475.0
Fso7g00275 WGDA 131 946 Eukaryotic Initiation Factors gene family AT5G43810 33.88 1.46e-134 427.0
Fso7g00395 WGDA 45 235 Eukaryotic Initiation Factors gene family AT4G18040 73.333 7.65e-109 311.0
Fso7g00397 ACH 56 216 Eukaryotic Initiation Factors gene family AT1G71770 25.61 1.47e-10 62.8
Fso7g00475 . 135 473 Eukaryotic Initiation Factors gene family AT1G49760 25.135 2.32e-16 79.7
Fso7g00493 . 35 407 Eukaryotic Initiation Factors gene family AT3G19760 28.75 9.55e-47 169.0
Fso7g00598 WGDA 192 516 Eukaryotic Initiation Factors gene family AT5G57870 37.647 6.05e-50 189.0
Fso7g00599 WGDA 192 780 Eukaryotic Initiation Factors gene family AT5G57870 29.607 1.59e-60 222.0
Fso7g00861 . 5 577 Eukaryotic Initiation Factors gene family AT4G20980 74.39 0.0 879.0
Fso7g01058 . 1 113 Eukaryotic Initiation Factors gene family AT4G27130 84.211 8.97e-71 205.0
Fso7g01177 . 37 188 Eukaryotic Initiation Factors gene family AT4G34110 28.659 2.87e-14 73.9
Fso7g01863 . 3 219 Eukaryotic Initiation Factors gene family AT1G56070 33.79 7.14e-24 105.0
Fso7g02011 . 314 383 Eukaryotic Initiation Factors gene family AT3G13920 32.857 1.10e-06 49.3
Fso8g00225 . 276 365 Eukaryotic Initiation Factors gene family AT3G19760 32.0 1.71e-07 53.5
Fso8g00247 WGDA 222 780 Eukaryotic Initiation Factors gene family AT5G57870 55.851 0.0 586.0
Fso8g00249 WGDA 3 780 Eukaryotic Initiation Factors gene family AT5G57870 61.45 0.0 900.0
Fso8g00343 WGDA 1 73 Eukaryotic Initiation Factors gene family AT3G56150 54.321 9.77e-16 68.2
Fso8g00438 WGDA 37 276 Eukaryotic Initiation Factors gene family AT4G34110 29.818 6.57e-26 108.0
Fso8g00518 WGDA 32 186 Eukaryotic Initiation Factors gene family AT1G53880 28.571 1.65e-10 58.2
Fso8g00623 . 33 177 Eukaryotic Initiation Factors gene family AT1G34140 26.752 2.09e-10 59.7
Fso8g00661 WGDA 136 206 Eukaryotic Initiation Factors gene family AT2G23350 41.667 1.73e-11 59.3
Fso8g00689 . 136 410 Eukaryotic Initiation Factors gene family AT2G23350 29.966 1.20e-26 111.0
Fso8g00719 . 16 629 Eukaryotic Initiation Factors gene family AT4G34110 70.505 0.0 883.0
Fso8g00923 . 1 439 Eukaryotic Initiation Factors gene family AT1G36730 64.108 0.0 524.0
Fso8g01054 . 1 414 Eukaryotic Initiation Factors gene family AT1G09640 72.662 0.0 610.0
Fso8g01261 . 39 390 Eukaryotic Initiation Factors gene family AT3G13920 31.215 1.64e-46 167.0
Fso8g01330 . 105 264 Eukaryotic Initiation Factors gene family AT3G16380 25.294 5.04e-06 47.0
Fso8g01452 WGDA 297 377 Eukaryotic Initiation Factors gene family AT2G36660 37.037 1.15e-10 58.9
Fso8g01840 ACH 233 661 Eukaryotic Initiation Factors gene family AT5G10630 37.156 1.93e-96 305.0
Fso8g02049 WGDA 5 158 Eukaryotic Initiation Factors gene family AT1G13950 87.097 1.85e-95 280.0
Fso8g02183 WGDA 86 532 Eukaryotic Initiation Factors gene family AT3G26400 49.076 3.58e-108 328.0
Fso8g02190 . 70 664 Eukaryotic Initiation Factors gene family AT5G10630 60.331 0.0 728.0
Fso8g02228 . 25 209 Eukaryotic Initiation Factors gene family AT3G13920 26.02 5.39e-11 62.8
Fso9g00099 WGDA 1 432 Eukaryotic Initiation Factors gene family AT3G26618 91.705 0.0 827.0
Fso9g00169 . 1 714 Eukaryotic Initiation Factors gene family AT2G34970 59.861 0.0 867.0
Fso9g00213 WGDA 227 393 Eukaryotic Initiation Factors gene family AT2G23350 32.022 1.87e-15 77.0
Fso9g00367 . 620 715 Eukaryotic Initiation Factors gene family AT5G57870 33.333 4.16e-09 58.2
Fso9g00375 WGDA 200 386 Eukaryotic Initiation Factors gene family AT3G16380 37.037 2.60e-25 103.0
Fso9g00493 ACH,WGDA 1 158 Eukaryotic Initiation Factors gene family AT1G69410 86.792 1.40e-101 286.0
Fso9g01336 WGDA 45 413 Eukaryotic Initiation Factors gene family AT5G11170 26.744 2.12e-39 147.0
Fso9g01340 ACH,WGDA 25 197 Eukaryotic Initiation Factors gene family AT1G53880 40.223 2.86e-37 134.0
Fso9g01341 . 37 408 Eukaryotic Initiation Factors gene family AT3G19760 37.634 8.22e-94 289.0
Fso9g01540 ACH,WGDA 126 297 Eukaryotic Initiation Factors gene family AT4G34110 34.946 9.44e-22 92.8
Fso9g01581 . 292 402 Eukaryotic Initiation Factors gene family AT2G23350 30.435 1.09e-09 56.6
Fso9g01640 . 33 401 Eukaryotic Initiation Factors gene family AT3G19760 31.888 1.63e-59 203.0
Fso9g01656 . 306 377 Eukaryotic Initiation Factors gene family AT3G16380 33.766 7.23e-07 49.7
Fso9g01659 . 32 221 Eukaryotic Initiation Factors gene family AT5G18110 81.152 7.67e-118 333.0
Fso9g01743 . 201 449 Eukaryotic Initiation Factors gene family AT5G60390 95.582 5.39e-177 492.0
Fso9g01744 ACH 1 155 Eukaryotic Initiation Factors gene family AT5G60390 98.71 3.06e-111 322.0
Fso9g01944 . 227 393 Eukaryotic Initiation Factors gene family AT2G23350 27.624 1.52e-11 64.7
Fso9g01947 . 43 116 Eukaryotic Initiation Factors gene family AT5G35620 36.486 1.32e-10 53.9
Fso10g00089 . 215 386 Eukaryotic Initiation Factors gene family AT4G34110 26.882 4.57e-14 71.6
Fso10g00330 . 38 185 Eukaryotic Initiation Factors gene family AT4G34110 22.414 2.80e-06 46.2
Fso10g00633 ACH 305 418 Eukaryotic Initiation Factors gene family AT2G36660 30.702 2.02e-11 61.2
Fso10g00838 . 335 449 Eukaryotic Initiation Factors gene family AT5G60390 92.174 1.82e-73 223.0
Fso10g00839 . 43 301 Eukaryotic Initiation Factors gene family AT5G60390 94.208 0.0 509.0
Fso10g00906 . 35 378 Eukaryotic Initiation Factors gene family AT3G19760 29.38 2.18e-46 166.0
Fso10g01537 . 217 275 Eukaryotic Initiation Factors gene family AT3G11400 45.763 5.14e-08 51.2
Fso10g01674 WGDA 1 145 Eukaryotic Initiation Factors gene family AT2G04520 91.034 2.98e-90 257.0
Fso10g01695 . 44 411 Eukaryotic Initiation Factors gene family AT1G49760 27.033 1.71e-17 85.1
Fso10g02096 . 1 245 Eukaryotic Initiation Factors gene family AT3G55620 84.898 3.80e-160 442.0
Fso10g02161 . 326 408 Eukaryotic Initiation Factors gene family AT2G23350 38.554 5.40e-11 60.8
Fso10g02242 . 42 197 Eukaryotic Initiation Factors gene family AT1G49760 32.749 1.30e-11 65.5
Fso10g02468 . 206 291 Eukaryotic Initiation Factors gene family AT3G11400 36.047 5.92e-12 60.5
Fso10g02673 . 8 441 Eukaryotic Initiation Factors gene family AT3G57290 85.484 0.0 801.0
Fso10g02875 . 227 405 Eukaryotic Initiation Factors gene family AT2G23350 25.269 5.23e-08 55.1
Fso10g02880 . 35 251 Eukaryotic Initiation Factors gene family AT2G34970 23.394 2.16e-08 54.3
Fso10g03128 . 41 407 Eukaryotic Initiation Factors gene family AT5G11170 32.172 1.43e-54 192.0
Fso10g03348 . 47 292 Eukaryotic Initiation Factors gene family AT1G49760 22.353 2.82e-13 72.0
Fso10g03413 . 28 353 Eukaryotic Initiation Factors gene family AT2G46290 82.209 0.0 565.0
Fso10g03492 ACH 58 345 Eukaryotic Initiation Factors gene family AT1G71770 25.49 3.35e-29 118.0
Fso10g03657 ACH 1 158 Eukaryotic Initiation Factors gene family AT1G69410 86.792 2.27e-101 286.0
Fso10g03679 . 726 817 Eukaryotic Initiation Factors gene family AT5G43810 44.086 2.44e-12 61.2
Fso10g03774 WGDA 3 429 Eukaryotic Initiation Factors gene family AT5G60390 29.613 9.58e-45 161.0
Fso10g03810 . 46 275 Eukaryotic Initiation Factors gene family AT2G46290 27.17 6.88e-10 58.5
Fso10g03813 WGDA 1 231 Eukaryotic Initiation Factors gene family AT2G18110 72.581 9.49e-107 306.0
Fso10g03954 WGDA 30 343 Eukaryotic Initiation Factors gene family AT2G46290 30.503 1.19e-42 149.0
Fso11g00198 . 131 988 Eukaryotic Initiation Factors gene family AT5G43810 35.857 4.23e-170 518.0
Fso11g00241 WGDA 33 176 Eukaryotic Initiation Factors gene family AT1G34140 25.641 1.17e-09 57.4
Fso11g00264 . 3 343 Eukaryotic Initiation Factors gene family AT2G40290 72.434 4.93e-178 495.0
Fso11g00265 WGDA 1 342 Eukaryotic Initiation Factors gene family AT2G40290 77.485 0.0 521.0
Fso11g00340 . 7 139 Eukaryotic Initiation Factors gene family AT3G22980 37.594 4.09e-22 100.0
Fso11g00388 ACH,WGDA 1 183 Eukaryotic Initiation Factors gene family AT1G53880 37.433 4.25e-35 128.0
Fso11g00632 . 53 383 Eukaryotic Initiation Factors gene family AT3G19760 19.945 1.32e-07 52.8
Fso11g00818 WGDA 20 257 Eukaryotic Initiation Factors gene family AT2G39990 22.348 1.90e-10 58.9
Fso11g00924 WGDA 329 407 Eukaryotic Initiation Factors gene family AT2G23350 41.25 3.30e-13 63.9
Fso11g01078 WGDA 233 407 Eukaryotic Initiation Factors gene family AT1G71770 29.121 2.28e-14 72.4
Fso11g01100 . 203 383 Eukaryotic Initiation Factors gene family AT2G36660 31.579 4.98e-15 75.5
Fso11g01101 WGDA 227 393 Eukaryotic Initiation Factors gene family AT2G23350 31.609 2.72e-14 73.6
Fso11g01134 . 131 988 Eukaryotic Initiation Factors gene family AT5G43810 36.901 3.89e-172 524.0
Fso11g01451 . 138 278 Eukaryotic Initiation Factors gene family AT1G22760 28.873 4.23e-12 62.8
Fso11g01544 . 277 385 Eukaryotic Initiation Factors gene family AT3G19760 22.727 7.24e-06 48.1
Fso11g01604 . 5 120 Eukaryotic Initiation Factors gene family AT1G57720 68.966 1.64e-51 167.0
Fso11g01605 . 1 236 Eukaryotic Initiation Factors gene family AT1G57720 62.5 1.01e-100 298.0
Fso11g01833 . 1 966 Eukaryotic Initiation Factors gene family AT4G11420 69.191 0.0 1263.0
Fso11g01943 . 291 383 Eukaryotic Initiation Factors gene family AT5G11170 30.851 3.18e-07 51.6
Fso11g01948 . 49 398 Eukaryotic Initiation Factors gene family AT3G13920 25.255 3.97e-31 122.0
Fso11g01950 . 306 372 Eukaryotic Initiation Factors gene family AT3G16380 35.294 2.56e-07 50.8
Fso11g02789 . 11 292 Eukaryotic Initiation Factors gene family AT3G11400 72.281 1.84e-154 431.0
Fso11g02914 . 24 389 Eukaryotic Initiation Factors gene family AT3G19760 37.067 5.41e-71 239.0
Fso11g02955 . 234 320 Eukaryotic Initiation Factors gene family AT1G71770 28.736 1.17e-08 54.7
Fso11g03110 . 40 407 Eukaryotic Initiation Factors gene family AT1G72730 25.113 2.64e-33 130.0
Fso12g00088 ACH 59 120 Eukaryotic Initiation Factors gene family AT1G71770 40.323 7.99e-06 43.5
Fso12g00124 . 345 1048 Eukaryotic Initiation Factors gene family AT1G48410 41.176 2.97e-178 533.0
Fso12g00189 . 1 245 Eukaryotic Initiation Factors gene family AT3G55620 91.02 2.43e-172 473.0
Fso12g00271 WGDA 131 946 Eukaryotic Initiation Factors gene family AT5G43810 33.958 2.25e-134 428.0
Fso12g00364 . 60 234 Eukaryotic Initiation Factors gene family AT4G18040 76.571 6.96e-105 301.0
Fso12g00366 WGDA 60 235 Eukaryotic Initiation Factors gene family AT4G18040 77.841 1.63e-107 308.0
Fso12g00568 . 217 780 Eukaryotic Initiation Factors gene family AT5G57870 29.531 8.00e-67 231.0
Fso12g00571 WGDA 192 507 Eukaryotic Initiation Factors gene family AT5G57870 38.298 2.91e-55 206.0
Fso12g00641 . 78 185 Eukaryotic Initiation Factors gene family AT3G16380 31.092 8.34e-12 59.3
Fso12g00952 . 203 383 Eukaryotic Initiation Factors gene family AT2G36660 28.723 2.03e-14 73.2
Fso12g01761 . 39 395 Eukaryotic Initiation Factors gene family AT3G13920 35.467 5.17e-68 224.0
Fso12g01895 . 1 194 Eukaryotic Initiation Factors gene family AT1G53880 28.218 1.80e-23 95.5
Fso12g01928 WGDA 3 429 Eukaryotic Initiation Factors gene family AT5G60390 30.664 1.55e-46 165.0
Fso12g02102 . 5 580 Eukaryotic Initiation Factors gene family AT4G20980 75.475 0.0 889.0
Fso12g02106 . 1 712 Eukaryotic Initiation Factors gene family AT5G27640 76.404 0.0 1161.0
Fso12g02126 . 113 382 Eukaryotic Initiation Factors gene family AT2G36660 24.265 3.84e-11 64.7
Fso12g02130 . 1 465 Eukaryotic Initiation Factors gene family AT1G04170 88.602 0.0 865.0
Fso12g02136 . 8 164 Eukaryotic Initiation Factors gene family AT3G22980 38.509 8.35e-22 99.0
Fso12g02217 WGDA 215 303 Eukaryotic Initiation Factors gene family AT4G34110 32.222 2.00e-09 56.2
Fso12g02370 . 47 287 Eukaryotic Initiation Factors gene family AT1G49760 23.81 7.23e-16 79.7
Fso12g02446 WGDA 43 412 Eukaryotic Initiation Factors gene family AT1G72730 36.567 4.83e-70 228.0
Fso12g02492 ACH 215 289 Eukaryotic Initiation Factors gene family AT3G11400 28.0 1.35e-08 51.6
Fso13g00034 . 196 580 Eukaryotic Initiation Factors gene family AT1G53880 78.626 0.0 596.0
Fso13g00085 . 22 389 Eukaryotic Initiation Factors gene family AT3G19760 33.511 2.84e-73 236.0
Fso13g00247 . 105 264 Eukaryotic Initiation Factors gene family AT3G16380 25.294 4.94e-06 47.0
Fso13g00440 . 45 183 Eukaryotic Initiation Factors gene family AT1G22760 26.875 9.66e-08 53.1
Fso13g00458 . 115 1048 Eukaryotic Initiation Factors gene family AT1G48410 80.19 0.0 1569.0
Fso13g00915 . 40 401 Eukaryotic Initiation Factors gene family AT3G19760 33.784 3.96e-65 217.0
Fso13g01180 . 239 311 Eukaryotic Initiation Factors gene family AT1G71770 31.081 7.11e-07 47.4
Fso13g01291 . 52 397 Eukaryotic Initiation Factors gene family AT1G72730 37.5 1.41e-65 222.0
Fso13g01324 . 366 413 Eukaryotic Initiation Factors gene family AT1G57720 91.667 6.68e-26 94.7
Fso13g01325 . 1 235 Eukaryotic Initiation Factors gene family AT1G57720 60.251 1.79e-98 294.0
Fso13g01350 . 1 138 Eukaryotic Initiation Factors gene family AT1G57720 63.043 1.14e-55 177.0
Fso13g01351 . 193 414 Eukaryotic Initiation Factors gene family AT1G09640 77.578 3.01e-124 356.0
Fso13g01457 . 210 293 Eukaryotic Initiation Factors gene family AT3G11400 33.333 2.37e-10 56.6
Fso13g01669 WGDA 136 206 Eukaryotic Initiation Factors gene family AT2G23350 43.056 8.06e-12 60.5
Fso13g01736 . 32 401 Eukaryotic Initiation Factors gene family AT3G19760 31.267 6.61e-63 207.0
Fso13g01836 WGDA 28 186 Eukaryotic Initiation Factors gene family AT1G53880 30.233 1.21e-14 70.1
Fso13g01959 WGDA 37 276 Eukaryotic Initiation Factors gene family AT4G34110 29.818 7.65e-26 108.0
Fso13g02037 WGDA 1 900 Eukaryotic Initiation Factors gene family AT3G56150 69.313 0.0 1212.0
Fso13g02149 . 356 394 Eukaryotic Initiation Factors gene family AT5G57870 76.923 4.13e-15 66.2
Fso13g02150 WGDA 447 780 Eukaryotic Initiation Factors gene family AT5G57870 55.357 8.51e-117 353.0
Fso13g02242 . 17 401 Eukaryotic Initiation Factors gene family AT3G19760 33.82 1.56e-61 207.0
Fso13g02286 . 1 347 Eukaryotic Initiation Factors gene family AT3G07300 75.921 0.0 509.0
Fso13g02392 . 1 412 Eukaryotic Initiation Factors gene family AT3G13920 92.271 0.0 788.0
Fso13g02428 . 7 226 Eukaryotic Initiation Factors gene family AT4G33250 76.126 1.95e-129 362.0
Fso13g02434 . 227 405 Eukaryotic Initiation Factors gene family AT2G23350 25.275 3.61e-09 58.5
Fso14g00136 . 551 1015 Eukaryotic Initiation Factors gene family AT3G22980 67.579 0.0 620.0
Fso14g00137 . 2 528 Eukaryotic Initiation Factors gene family AT3G22980 78.491 0.0 872.0
Fso14g00251 . 56 220 Eukaryotic Initiation Factors gene family AT1G71770 27.381 1.22e-11 66.2
Fso14g00489 WGDA 1 158 Eukaryotic Initiation Factors gene family AT1G13950 87.421 3.80e-101 285.0
Fso14g00617 WGDA 1 532 Eukaryotic Initiation Factors gene family AT3G26400 48.793 7.92e-123 369.0
Fso14g00870 ACH,WGDA 297 377 Eukaryotic Initiation Factors gene family AT2G36660 37.037 1.04e-10 58.9
Fso14g00927 . 59 304 Eukaryotic Initiation Factors gene family AT1G71770 23.256 1.63e-14 75.9
Fso14g00937 . 34 411 Eukaryotic Initiation Factors gene family AT1G72730 29.676 2.74e-40 150.0
Fso14g00951 . 226 407 Eukaryotic Initiation Factors gene family AT1G49760 21.693 4.23e-07 49.7
Fso14g01024 . 14 411 Eukaryotic Initiation Factors gene family AT3G13920 30.456 1.25e-57 197.0
Fso14g01241 WGDA 44 670 Eukaryotic Initiation Factors gene family AT1G49760 70.476 0.0 858.0
Fso14g01482 . 287 428 Eukaryotic Initiation Factors gene family AT1G71770 27.152 3.83e-12 63.9
Fso14g01562 . 134 1294 Eukaryotic Initiation Factors gene family AT1G76810 63.675 0.0 1164.0
Fso14g02002 . 206 292 Eukaryotic Initiation Factors gene family AT3G11400 34.483 6.21e-13 61.2
Fso14g02135 ACH 1 268 Eukaryotic Initiation Factors gene family AT5G20920 74.539 1.66e-133 376.0
Fso14g02499 WGDA 1 189 Eukaryotic Initiation Factors gene family AT1G53880 31.373 1.25e-22 93.6
Fso14g02570 . 214 288 Eukaryotic Initiation Factors gene family AT1G22760 29.333 2.49e-06 42.0
Fso15g00121 . 150 209 Eukaryotic Initiation Factors gene family AT5G43810 36.667 7.41e-08 45.8
Fso15g00135 . 33 183 Eukaryotic Initiation Factors gene family AT1G34140 25.153 1.85e-09 56.6
Fso15g01506 . 125 366 Eukaryotic Initiation Factors gene family AT4G34110 24.46 6.49e-13 68.6
Fso15g01508 . 234 292 Eukaryotic Initiation Factors gene family AT3G11400 37.288 2.69e-06 41.2
Fso15g01884 . 37 408 Eukaryotic Initiation Factors gene family AT3G19760 37.903 1.34e-93 289.0
Fso15g02050 . 54 120 Eukaryotic Initiation Factors gene family AT1G71770 39.706 7.67e-07 51.2
Fso15g02129 . 30 250 Eukaryotic Initiation Factors gene family AT2G39990 29.06 1.59e-26 104.0
Fso15g02172 . 41 413 Eukaryotic Initiation Factors gene family AT1G72730 32.812 1.70e-56 192.0
Fso15g02234 WGDA 59 120 Eukaryotic Initiation Factors gene family AT1G71770 38.71 4.54e-06 44.3
Fso15g02417 . 18 408 Eukaryotic Initiation Factors gene family AT3G19760 89.003 0.0 731.0
Fso15g02421 WGDA 16 277 Eukaryotic Initiation Factors gene family AT4G34110 27.019 1.03e-14 76.3
Fso15g02730 . 1 158 Eukaryotic Initiation Factors gene family AT1G13950 88.05 7.08e-102 287.0
Fso15g02769 . 76 375 Eukaryotic Initiation Factors gene family AT3G19760 22.157 5.24e-06 48.1
Fso16g00038 . 7 111 Eukaryotic Initiation Factors gene family AT2G04520 31.858 4.63e-06 42.7
Fso16g00270 . 3 85 Eukaryotic Initiation Factors gene family AT2G39990 73.494 4.50e-39 129.0
Fso16g00313 WGDA 24 178 Eukaryotic Initiation Factors gene family AT4G18300 23.871 8.06e-08 52.4
Fso16g00478 WGDA 610 701 Eukaryotic Initiation Factors gene family AT4G18300 30.435 5.25e-08 53.1
Fso16g00506 WGDA 42 118 Eukaryotic Initiation Factors gene family AT1G49760 29.87 1.47e-08 50.4
Fso16g01387 . 1 337 Eukaryotic Initiation Factors gene family AT1G10840 83.824 0.0 589.0
Fso16g01744 . 187 382 Eukaryotic Initiation Factors gene family AT3G16380 28.502 2.25e-17 80.1
Fso16g01796 . 181 214 Eukaryotic Initiation Factors gene family AT5G20920 85.294 1.08e-12 61.2
Fso17g00220 . 211 289 Eukaryotic Initiation Factors gene family AT3G11400 37.975 2.03e-10 58.2
Fso17g00374 . 38 185 Eukaryotic Initiation Factors gene family AT4G34110 25.581 2.22e-07 50.1
Fso17g00545 . 172 609 Eukaryotic Initiation Factors gene family AT5G27640 20.751 2.91e-19 89.4
Fso17g01288 . 249 407 Eukaryotic Initiation Factors gene family AT3G19760 24.868 1.39e-13 66.6
Fso17g01494 WGDA 25 154 Eukaryotic Initiation Factors gene family AT1G10840 28.03 8.53e-09 54.3
Fso17g01679 WGDA 3 429 Eukaryotic Initiation Factors gene family AT5G60390 29.613 3.25e-45 162.0
Fso17g01720 WGDA 1 231 Eukaryotic Initiation Factors gene family AT2G18110 79.221 2.13e-115 327.0
Fso17g01827 . 65 427 Eukaryotic Initiation Factors gene family AT5G11170 94.215 0.0 706.0
Fso17g01835 WGDA 30 343 Eukaryotic Initiation Factors gene family AT2G46290 30.189 2.38e-41 145.0
Fso17g01921 . 187 382 Eukaryotic Initiation Factors gene family AT3G16380 29.703 8.50e-15 74.3
Fso18g00033 . 1 367 Eukaryotic Initiation Factors gene family AT2G05830 75.339 0.0 541.0
Fso18g00513 . 112 1048 Eukaryotic Initiation Factors gene family AT1G48410 81.204 0.0 1594.0
Fso18g00515 . 233 661 Eukaryotic Initiation Factors gene family AT5G10630 36.468 3.79e-95 301.0
Fso18g00593 . 24 426 Eukaryotic Initiation Factors gene family AT4G18300 22.708 7.00e-15 75.1
Fso18g00987 . 131 988 Eukaryotic Initiation Factors gene family AT5G43810 35.373 4.30e-167 511.0
Fso18g01157 . 216 410 Eukaryotic Initiation Factors gene family AT2G23350 30.256 3.11e-16 81.3
Fso18g01260 . 1 198 Eukaryotic Initiation Factors gene family AT5G35620 64.216 1.94e-88 256.0
Fso18g01484 . 224 312 Eukaryotic Initiation Factors gene family AT1G49760 31.111 1.10e-08 54.3
Fso18g01486 . 224 312 Eukaryotic Initiation Factors gene family AT1G49760 31.111 1.16e-08 54.3
Fso18g01544 . 47 118 Eukaryotic Initiation Factors gene family AT1G49760 43.056 5.77e-13 63.2
Fso18g01615 . 30 176 Eukaryotic Initiation Factors gene family AT1G34140 25.786 1.60e-10 60.1
Fso18g01627 . 123 196 Eukaryotic Initiation Factors gene family AT4G34110 38.667 9.62e-12 60.1
Fso18g01676 . 126 986 Eukaryotic Initiation Factors gene family AT5G43810 35.301 2.99e-152 472.0
Fso18g01767 . 59 271 Eukaryotic Initiation Factors gene family AT5G65250 50.45 1.28e-62 198.0
Fso18g01951 . 326 408 Eukaryotic Initiation Factors gene family AT1G49760 34.524 5.30e-09 54.3
Fso18g02204 . 39 390 Eukaryotic Initiation Factors gene family AT3G13920 31.215 9.32e-46 165.0
Fso18g02229 . 136 421 Eukaryotic Initiation Factors gene family AT2G23350 27.213 9.80e-17 82.0
Fso18g02293 . 33 400 Eukaryotic Initiation Factors gene family AT3G19760 34.646 5.97e-66 220.0
Fso18g02460 ACH 1 449 Eukaryotic Initiation Factors gene family AT5G60390 96.659 0.0 901.0
Fso18g02475 . 33 382 Eukaryotic Initiation Factors gene family AT3G19760 30.303 2.59e-57 195.0
Fso18g02547 WGDA 42 133 Eukaryotic Initiation Factors gene family AT1G49760 28.261 1.15e-07 50.4
Fso18g02578 WGDA 610 701 Eukaryotic Initiation Factors gene family AT4G18300 30.435 2.52e-08 54.3
Fso18g02606 . 316 409 Eukaryotic Initiation Factors gene family AT1G49760 38.947 6.44e-14 65.5
Fso18g02748 . 220 291 Eukaryotic Initiation Factors gene family AT2G23350 34.722 2.09e-06 47.0
Fso18g02781 . 327 403 Eukaryotic Initiation Factors gene family AT2G23350 31.169 1.17e-07 50.1
Fso18g02796 . 45 290 Eukaryotic Initiation Factors gene family AT1G49760 27.907 5.70e-18 85.1
Fso18g02803 . 182 290 Eukaryotic Initiation Factors gene family AT3G11400 34.234 2.12e-07 48.9
Fso18g02827 WGDA 24 178 Eukaryotic Initiation Factors gene family AT4G18300 23.871 9.04e-08 52.0
Fso18g02919 . 3 293 Eukaryotic Initiation Factors gene family AT2G39990 76.289 8.36e-158 439.0
Fso18g02988 . 304 499 Eukaryotic Initiation Factors gene family AT3G16380 30.288 4.10e-14 73.9
Fso10001156.1g00003 . 18 277 Eukaryotic Initiation Factors gene family AT4G34110 28.873 7.09e-29 117.0
Fso10000264.1g00013 . 1 113 Eukaryotic Initiation Factors gene family AT1G54290 79.825 9.07e-65 190.0
Fso10001594.1g00003 . 182 290 Eukaryotic Initiation Factors gene family AT3G11400 34.234 2.06e-07 49.3
Fso10000108.1g00004 . 136 206 Eukaryotic Initiation Factors gene family AT2G23350 34.247 5.98e-06 47.0
Fso10000522.1g00007 . 29 403 Eukaryotic Initiation Factors gene family AT3G19760 27.93 1.07e-44 164.0
Fso10000203.1g00006 . 37 401 Eukaryotic Initiation Factors gene family AT3G19760 38.082 3.55e-93 286.0
Fso10000466.1g00007 . 226 406 Eukaryotic Initiation Factors gene family AT1G49760 25.0 1.66e-09 55.8
Fso10000458.1g00001 . 136 206 Eukaryotic Initiation Factors gene family AT2G23350 43.056 1.08e-11 59.7
Fso10000932.1g00005 . 148 508 Eukaryotic Initiation Factors gene family AT1G71770 26.902 3.09e-20 92.0
Fso10000191.1g00002 . 1 189 Eukaryotic Initiation Factors gene family AT1G53880 27.586 2.65e-17 77.8
Fso10000191.1g00003 . 32 189 Eukaryotic Initiation Factors gene family AT1G53880 28.743 6.83e-14 67.8
Fso10000191.1g00004 . 32 189 Eukaryotic Initiation Factors gene family AT1G53880 28.743 6.83e-14 67.8
Fso10000191.1g00005 . 32 189 Eukaryotic Initiation Factors gene family AT1G53880 28.743 6.83e-14 67.8
Fso10000053.1g00003 . 1 69 Eukaryotic Initiation Factors gene family AT4G27130 81.159 5.11e-40 127.0
Fso10000447.1g00002 . 305 417 Eukaryotic Initiation Factors gene family AT2G36660 32.174 1.85e-09 57.0
Fso10001767.1g00001 . 9 138 Eukaryotic Initiation Factors gene family AT3G22980 43.846 1.51e-26 106.0
Fso10000250.1g00004 . 203 384 Eukaryotic Initiation Factors gene family AT4G34110 32.461 1.72e-15 74.7
Fso10000639.1g00001 . 36 82 Eukaryotic Initiation Factors gene family AT4G34110 38.298 7.67e-06 41.2
Fso10001053.1g00002 . 1 194 Eukaryotic Initiation Factors gene family AT1G53880 28.218 1.80e-23 95.5
Fso10000839.1g00001 . 22 114 Eukaryotic Initiation Factors gene family AT3G16380 53.763 1.04e-27 103.0
Fso10000839.1g00002 . 22 398 Eukaryotic Initiation Factors gene family AT3G16380 47.09 2.91e-108 328.0
Fso10000107.1g00014 . 1 446 Eukaryotic Initiation Factors gene family AT5G60390 97.309 0.0 899.0
Fso10000107.1g00015 . 33 401 Eukaryotic Initiation Factors gene family AT3G19760 31.467 1.16e-56 192.0
Fso10000943.1g00001 . 204 379 Eukaryotic Initiation Factors gene family AT3G16380 34.078 1.01e-20 89.4
Fso10000862.1g00004 . 3 429 Eukaryotic Initiation Factors gene family AT5G60390 29.613 8.68e-45 161.0
Fso10001447.1g00006 . 42 398 Eukaryotic Initiation Factors gene family AT1G72730 25.98 6.74e-35 134.0
Fso10001489.1g00004 . 1 156 Eukaryotic Initiation Factors gene family AT5G11170 80.892 7.84e-82 246.0
Fso10001489.1g00005 . 202 427 Eukaryotic Initiation Factors gene family AT5G11170 98.23 5.83e-164 457.0
Fso10000881.1g00009 . 123 209 Eukaryotic Initiation Factors gene family AT1G22760 32.967 2.18e-06 49.7
Fso10001463.1g00001 . 1 641 Eukaryotic Initiation Factors gene family AT5G38640 62.594 0.0 750.0
Fso10000352.1g00009 . 46 386 Eukaryotic Initiation Factors gene family AT3G13920 24.574 2.81e-25 106.0
Fso10001420.1g00005 . 204 383 Eukaryotic Initiation Factors gene family AT3G16380 33.333 1.16e-18 84.0
Fso10001617.1g00004 . 326 408 Eukaryotic Initiation Factors gene family AT1G49760 34.524 5.40e-09 54.3
Fso10000469.1g00011 . 226 406 Eukaryotic Initiation Factors gene family AT1G49760 25.0 1.66e-09 55.8
Fso10000984.1g00003 . 126 295 Eukaryotic Initiation Factors gene family AT4G34110 22.843 4.82e-06 45.4
Fso10000118.1g00001 . 174 207 Eukaryotic Initiation Factors gene family AT5G12110 64.706 5.87e-08 45.8
Fso10001103.1g00001 . 26 629 Eukaryotic Initiation Factors gene family AT4G34110 71.543 0.0 877.0
Fso10000946.1g00001 . 1 194 Eukaryotic Initiation Factors gene family AT1G53880 28.218 1.80e-23 95.5
Fso10001118.1g00005 . 136 206 Eukaryotic Initiation Factors gene family AT2G23350 43.056 8.70e-12 60.1
Fso10000701.1g00004 . 1 113 Eukaryotic Initiation Factors gene family AT1G54290 80.702 1.11e-65 192.0
Fso10001572.1g00001 . 1 198 Eukaryotic Initiation Factors gene family AT5G35620 64.216 1.94e-88 256.0