AGRP Logo

AGRP

Asteraceae Genomic Research Platform

Gene Search

Example:
Example:

Gene details

leaf

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Hean1g00065 ATGTCGAACGCCGTCCTGAACGGCCTCGCCGGAGCCGGCGGAGGCATCATCGCTCAAATCATCACATATCCTCTTCAATCGGTCAACACGCGCCAACAGACGGAGAGAATTGCGAAGAAATCTCAGAGATCATCTGGTGGTACACTTGTTCAATTACTTGAGGTTATACGAAGCGAAGGGATTGGAGGATTATACAGCGGACTTAAGCCGTCTCTGCTTGGAACTGCTGCATCACAGGGGATTTATTATTATTTTTACCAGGTTTTTAAAAACAAAGCTGAAGCTATTGCAGCTTCTAATAAACGAAAGGGTCGTGGAGATGGAACAGTTGGTATGTTCGGCTGGCTCGTTGTGGCTGCTTTAGCAGGGTCACTGAATGTACTGTTTACAAATCCAATATGGGTGCTTGTGACACGTATGCAGACACACACTCAAGCAGAACGTAAGATTCTAGAAGCAAAGAAGGAGGCTCTGGTAAGAGAATGTTCCGAAAGCAGTCTGATTGGTTCTGCTTTGCATGATAAGTTGCGTGAACTCGATTCAGTGAAGCCTAACCCATACGGAACATTACACGCGGCGTCCGAAGTTTATAACGAAGCGGGAATACGGGGATTTTGGAAAGGCCTTGTTCCTACTTTAATCATGGTGTGCAATCCGTCAATTCAGTTCATGATATATGAGACGGCTTTAAAGTACTTGAAAGCTAAACGTGCTGATAAGAAGCAAAGTTCAAATAAAGTTTCTGCTCTGGAGGTATTTGTAGTAGGTGCCATTGCTAAACTTGGAGCAACTGTGACGACATATCCTTTGTTAGTTGTAAAGTCAAGACTTCAAGCAAAGCAAGAAATCAGCACAAACAATTCATTGAGATATTCAGGTACCCTGGATGCAATTGTAAAAATGATCCATTATGAAGGAATATCTAGCTTCTACAAAGGAATGAGCACCAAGATAGTACAGAGTGTATTTGCAGCTTCTGTGCTTTTCATGATCAAGGAGGAGCTGGTTAATTTTTTTGGCATGTTAGCGAAGAAGAGCCAAAAAATATTATTAAAAATGTCAAATTAG 1068 42.32 MSNAVLNGLAGAGGGIIAQIITYPLQSVNTRQQTERIAKKSQRSSGGTLVQLLEVIRSEGIGGLYSGLKPSLLGTAASQGIYYYFYQVFKNKAEAIAASNKRKGRGDGTVGMFGWLVVAALAGSLNVLFTNPIWVLVTRMQTHTQAERKILEAKKEALVRECSESSLIGSALHDKLRELDSVKPNPYGTLHAASEVYNEAGIRGFWKGLVPTLIMVCNPSIQFMIYETALKYLKAKRADKKQSSNKVSALEVFVVGAIAKLGATVTTYPLLVVKSRLQAKQEISTNNSLRYSGTLDAIVKMIHYEGISSFYKGMSTKIVQSVFAASVLFMIKEELVNFFGMLAKKSQKILLKMSN 355
leaf

Annotation information

Select Seq ID Length Analysis Description Start End IPR GO
Hean1g00065 355 Pfam Mitochondrial carrier protein 5 91 IPR018108 -
Hean1g00065 355 Pfam Mitochondrial carrier protein 247 339 IPR018108 -
Hean1g00065 355 Pfam Mitochondrial carrier protein 187 235 IPR018108 -
Hean1g00065 355 SUPERFAMILY Mitochondrial carrier 4 334 IPR023395 -
Hean1g00065 355 ProSiteProfiles Solute carrier (Solcar) repeat profile. 110 232 IPR018108 -
Hean1g00065 355 ProSiteProfiles Solute carrier (Solcar) repeat profile. 247 338 IPR018108 -
Hean1g00065 355 PANTHER MITOCHONDRIAL NICOTINAMIDE ADENINE DINUCLEOTIDE TRANSPORTER 1-RELATED-RELATED 3 350 IPR044712 GO:0006862(InterPro)|GO:0022857(PANTHER)|GO:0055085(PANTHER)|GO:0055085(InterPro)
Hean1g00065 355 Gene3D Mitochondrial carrier domain 10 350 IPR023395 -
Hean1g00065 355 ProSiteProfiles Solute carrier (Solcar) repeat profile. 2 92 IPR018108 -
leaf

Pathway information

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Hean1g00065 K13354 solute carrier family 25 (peroxisomal adenine nucleotide transporter), member 17
leaf

Duplication type information

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
3228966 Hean Hean1g00065 Hean-Chr1:1788187 Hean7g02837 Hean-Chr7:142948954
3249157 Hean Hean9g01669 Hean-Chr9:100477591 Hean1g00065 Hean-Chr1:1788187
3269442 Hean Hean1g00065 Hean-Chr1:1788187 Hean12g00104 Hean-Chr12:1703752
leaf

Gene Family Members

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Hean17g00845 . 33 254 Chloroplast and Mitochondria gene family AT3G61470 90.541 7.69e-150 417.0
Hean17g02141 . 2 373 Chloroplast and Mitochondria gene family AT5G14040 76.882 0.0 572.0
Hean17g02184 . 2 236 Chloroplast and Mitochondria gene family AT1G26100 64.754 5.84e-96 279.0
Hean17g02613 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.194 2.30e-170 469.0
Hean17g03814 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 85.768 3.88e-170 469.0
Hean17g04080 ACH,WGDA 4 211 Chloroplast and Mitochondria gene family AT4G25570 44.231 2.60e-59 185.0
Hean16g00306 . 42 307 Chloroplast and Mitochondria gene family AT5G40810 84.27 1.40e-150 420.0
Hean16g01504 . 1 72 Chloroplast and Mitochondria gene family AT5G05370 63.889 2.92e-33 107.0
Hean16g01529 . 1 346 Chloroplast and Mitochondria gene family AT1G72820 61.85 9.32e-144 408.0
Hean16g02347 . 1 258 Chloroplast and Mitochondria gene family AT1G15820 81.226 4.30e-151 422.0
Hean16g03891 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.94 1.51e-170 470.0
Hean16g03892 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 82.156 1.05e-161 447.0
Hean16g04130 WGDA 18 220 Chloroplast and Mitochondria gene family AT1G14730 38.462 4.09e-43 143.0
Hean15g00023 . 14 287 Chloroplast and Mitochondria gene family AT5G01530 84.307 5.38e-166 460.0
Hean15g01361 ACH 2 373 Chloroplast and Mitochondria gene family AT5G14040 75.198 0.0 562.0
Hean15g01740 . 1 305 Chloroplast and Mitochondria gene family AT2G17270 65.574 1.12e-157 441.0
Hean15g01980 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.687 5.55e-172 473.0
Hean15g01981 . 24 267 Chloroplast and Mitochondria gene family AT1G29910 88.571 3.24e-160 444.0
Hean15g01983 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.94 9.09e-171 470.0
Hean15g03321 ACH,WGDA 42 307 Chloroplast and Mitochondria gene family AT3G27240 93.233 2.74e-174 481.0
Hean15g03544 . 276 315 Chloroplast and Mitochondria gene family AT5G15640 72.5 3.40e-15 66.6
Hean15g03880 . 1 273 Chloroplast and Mitochondria gene family AT1G61520 89.011 2.38e-172 475.0
Hean15g04022 . 2 264 Chloroplast and Mitochondria gene family AT2G05070 67.286 1.01e-122 348.0
Hean15g04203 . 1 300 Chloroplast and Mitochondria gene family AT4G25700 62.651 1.14e-144 409.0
Hean14g00018 . 30 327 Chloroplast and Mitochondria gene family AT1G76570 76.589 1.04e-177 493.0
Hean14g00195 . 6 251 Chloroplast and Mitochondria gene family AT1G29930 83.333 7.84e-145 404.0
Hean14g01927 . 29 300 Chloroplast and Mitochondria gene family AT2G47490 37.5 1.59e-47 160.0
Hean14g02364 . 33 294 Chloroplast and Mitochondria gene family AT1G25380 29.577 1.56e-13 68.9
Hean14g02694 ACH,WGDA 1 228 Chloroplast and Mitochondria gene family AT5G38630 67.982 3.01e-113 322.0
Hean14g02959 ACH 1 307 Chloroplast and Mitochondria gene family AT5G40810 85.484 0.0 508.0
Hean14g03011 ACH,WGDA 315 373 Chloroplast and Mitochondria gene family AT5G14040 81.356 7.77e-28 102.0
Hean14g03012 WGDA 2 211 Chloroplast and Mitochondria gene family AT5G14040 63.333 3.82e-82 247.0
Hean14g04307 . 1 239 Chloroplast and Mitochondria gene family AT4G25570 65.272 2.90e-111 317.0
Hean13g00478 . 21 264 Chloroplast and Mitochondria gene family AT5G15640 62.705 1.83e-100 294.0
Hean13g03365 . 51 159 Chloroplast and Mitochondria gene family AT5G38630 60.55 4.82e-41 136.0
Hean12g00312 . 316 359 Chloroplast and Mitochondria gene family AT5G14040 63.636 7.01e-13 60.5
Hean12g00313 . 84 169 Chloroplast and Mitochondria gene family AT5G14040 39.773 3.17e-09 50.4
Hean12g00314 . 314 346 Chloroplast and Mitochondria gene family AT5G14040 69.697 4.55e-10 52.0
Hean12g00560 WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 69.653 2.80e-164 460.0
Hean12g00732 WGDA 7 187 Chloroplast and Mitochondria gene family AT1G17530 62.431 1.38e-72 215.0
Hean12g01222 . 33 327 Chloroplast and Mitochondria gene family AT1G25380 65.116 2.07e-140 400.0
Hean12g01802 . 1 239 Chloroplast and Mitochondria gene family AT3G54890 82.917 6.18e-143 398.0
Hean12g03295 ACH 1 228 Chloroplast and Mitochondria gene family AT5G38630 65.351 1.61e-108 310.0
Hean11g00548 . 2 280 Chloroplast and Mitochondria gene family AT4G10340 82.624 1.53e-152 426.0
Hean11g00550 . 2 280 Chloroplast and Mitochondria gene family AT4G10340 82.624 3.63e-153 427.0
Hean11g00707 . 18 273 Chloroplast and Mitochondria gene family AT1G61520 88.672 1.73e-170 470.0
Hean11g02194 WGDA 51 447 Chloroplast and Mitochondria gene family AT2G28800 76.355 0.0 598.0
Hean10g00120 . 41 325 Chloroplast and Mitochondria gene family AT1G07030 32.753 4.11e-34 125.0
Hean10g00137 . 89 126 Chloroplast and Mitochondria gene family AT2G28800 63.415 2.30e-07 47.4
Hean10g00942 . 133 190 Chloroplast and Mitochondria gene family AT5G15640 74.138 2.42e-24 96.7
Hean10g01613 . 99 260 Chloroplast and Mitochondria gene family AT5G15640 68.519 5.49e-75 225.0
Hean10g01639 . 1 71 Chloroplast and Mitochondria gene family AT2G34430 67.606 1.44e-23 90.1
Hean10g02092 ACH 1 258 Chloroplast and Mitochondria gene family AT1G15820 81.992 3.79e-151 423.0
Hean10g03185 ACH,WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 70.845 8.66e-168 469.0
Hean10g03452 WGDA 6 187 Chloroplast and Mitochondria gene family AT1G17530 62.637 1.86e-74 220.0
Hean9g01015 ACH 1 343 Chloroplast and Mitochondria gene family AT1G72820 67.052 2.79e-157 442.0
Hean9g02153 ACH,WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 86.408 0.0 513.0
Hean9g03268 . 11 320 Chloroplast and Mitochondria gene family AT5G15640 69.032 2.36e-168 469.0
Hean9g03269 . 1 320 Chloroplast and Mitochondria gene family AT5G15640 73.125 3.68e-176 492.0
Hean9g03674 . 37 254 Chloroplast and Mitochondria gene family AT3G61470 46.154 7.08e-61 191.0
Hean9g04384 ACH 70 362 Chloroplast and Mitochondria gene family AT5G14040 81.229 0.0 508.0
Hean9g04760 . 1 345 Chloroplast and Mitochondria gene family AT1G72820 67.422 3.23e-173 483.0
Hean8g00138 . 36 407 Chloroplast and Mitochondria gene family AT2G28800 60.101 1.52e-158 458.0
Hean8g01167 . 1 239 Chloroplast and Mitochondria gene family AT3G54890 85.0 5.32e-147 408.0
Hean8g01835 . 136 224 Chloroplast and Mitochondria gene family AT1G14730 48.315 4.34e-21 82.4
Hean8g01836 ACH 4 134 Chloroplast and Mitochondria gene family AT4G25570 52.672 8.80e-45 145.0
Hean8g01837 . 1 224 Chloroplast and Mitochondria gene family AT1G14730 61.607 2.37e-90 263.0
Hean8g02991 . 1 265 Chloroplast and Mitochondria gene family AT2G05100 67.528 5.20e-122 347.0
Hean8g03322 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 56.219 1.42e-75 228.0
Hean7g01228 . 5 309 Chloroplast and Mitochondria gene family AT2G17270 63.607 1.66e-148 417.0
Hean7g01363 . 74 308 Chloroplast and Mitochondria gene family AT1G25380 35.659 2.41e-38 136.0
Hean7g02342 WGDA 2 367 Chloroplast and Mitochondria gene family AT5G14040 77.596 0.0 573.0
Hean7g02344 ACH,WGDA 2 367 Chloroplast and Mitochondria gene family AT5G14040 77.596 0.0 573.0
Hean7g02375 ACH 1 307 Chloroplast and Mitochondria gene family AT5G40810 84.516 0.0 500.0
Hean7g02591 ACH,WGDA 18 228 Chloroplast and Mitochondria gene family AT5G38630 46.919 3.36e-58 179.0
Hean7g02837 . 37 310 Chloroplast and Mitochondria gene family AT1G25380 26.623 3.73e-28 110.0
Hean6g00840 . 4 580 Chloroplast and Mitochondria gene family AT4G21490 67.126 0.0 793.0
Hean6g01110 . 176 225 Chloroplast and Mitochondria gene family AT5G14040 72.0 1.09e-17 75.9
Hean6g01384 . 33 254 Chloroplast and Mitochondria gene family AT3G61470 90.541 1.06e-149 417.0
Hean5g00648 . 38 548 Chloroplast and Mitochondria gene family AT2G18710 81.081 0.0 837.0
Hean5g01407 . 28 270 Chloroplast and Mitochondria gene family AT4G03320 36.694 6.75e-45 150.0
Hean5g02729 . 1 354 Chloroplast and Mitochondria gene family AT5G54290 67.036 1.27e-145 414.0
Hean5g02890 ACH 1 367 Chloroplast and Mitochondria gene family AT5G14040 72.752 0.0 556.0
Hean5g03169 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 56.219 1.05e-75 229.0
Hean5g03433 . 169 354 Chloroplast and Mitochondria gene family AT4G21490 75.936 6.27e-90 272.0
Hean4g03128 . 270 426 Chloroplast and Mitochondria gene family AT4G21490 58.228 1.73e-53 177.0
Hean4g03563 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.313 3.66e-172 474.0
Hean4g03565 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.687 9.50e-172 473.0
Hean4g04275 . 51 257 Chloroplast and Mitochondria gene family AT3G61470 66.184 3.53e-102 298.0
Hean3g01277 ACH 1 258 Chloroplast and Mitochondria gene family AT1G15820 78.682 2.40e-146 408.0
Hean3g02170 . 1 265 Chloroplast and Mitochondria gene family AT2G05100 90.566 0.0 499.0
Hean2g00294 . 3 145 Chloroplast and Mitochondria gene family AT1G07020 43.537 7.50e-21 80.9
Hean2g00318 ACH 1 364 Chloroplast and Mitochondria gene family AT5G14040 76.374 0.0 560.0
Hean2g02142 WGDA 12 316 Chloroplast and Mitochondria gene family AT1G07030 29.642 7.33e-33 127.0
Hean2g02432 . 99 264 Chloroplast and Mitochondria gene family AT5G15640 50.0 9.56e-40 134.0
Hean1g00065 . 33 300 Chloroplast and Mitochondria gene family AT2G47490 30.094 3.35e-31 118.0
Hean1g00088 . 1 307 Chloroplast and Mitochondria gene family AT2G47490 77.922 1.19e-165 461.0
Hean1g00717 . 257 313 Chloroplast and Mitochondria gene family AT5G14040 70.175 5.68e-22 84.3
Hean1g00858 . 15 287 Chloroplast and Mitochondria gene family AT5G01530 82.246 3.49e-157 439.0
Hean1g01283 WGDA 40 449 Chloroplast and Mitochondria gene family AT2G28800 73.735 0.0 605.0
Hean1g01473 . 1 329 Chloroplast and Mitochondria gene family AT2G30160 69.162 7.70e-162 453.0
Hean1g01610 . 1 72 Chloroplast and Mitochondria gene family AT5G05370 65.278 2.46e-32 105.0
Hean1g01986 . 1 266 Chloroplast and Mitochondria gene family AT2G34430 86.842 6.02e-169 466.0