AGRP Logo

AGRP

Asteraceae Genomic Research Platform

Gene Search

Example:
Example:

Gene details

leaf

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Mimi16g02079 ATGTCGAACGCCGTCGTGAACGGCCTCGCCGGAGCCGGCGGAGGTATAATTGCTCAAATCATCACATATCCTCTCCAATCGGTCAATACTCGGCAACAGACGGAGAGAATCGCAAAGAAGTCTCGGTCTCAGGGATCATCTGGCGGTACACTTGTTCAATTAATTGAGGTTATACGAACCGAGGGGATTGGAGGATTATACAGCGGCCTTAAGCCTTCTCTGCTCGGAACTGCTGCATCACAGGGCATTTATTATTATTTTTACCAGGTTTTTAAAAATAAAGCCGAATCTATTGCAGCTTCTAATAAAAGAAAGGGTCGTGGGGATGGTACGGTTGGCATGTTCTCGTGGCTTGTTGTGGCTGCTTTAGCTGGGGCACTGAATGTCTTGTTTACAAACCCGATATGGGTGCTTGTGACACGTATGCAGACACACACTCAAGCAGAACAGAAGATTCTAGAAGCAAAGAAGGAAGCTCTCTTAAGAGAATGTTCTGAAAGCAGTTTAATTGGTACTTCTTTGCATGATAAGTTGCGTGAAATCGATTCAGTGAAGCCTAATCCGTATGGAACATTGCACGCGGCTTACGAGGTTTATAACGAAGCTGGAATACGAGGATTCTGGAAAGGCATTGTTCCTACTTTAATCATGGTATGCAATCCATCAATTCAATTCATGATATATGAGACATCTCTAAAGTACTTGAAATCTAAACGTGCTGATAAGAAGCAAAGTTCAAGTAAAGTTACTGCTTTGGAGGTATTTGTAGTAGGTGCCATTGCTAAACTTGGAGCAACTGTGACGACATATCCTTTATTGGTTGTAAAGTCAAGACTTCAAGCAAAGCAAGAAATTAGTACAAGCAATTCATTGAGATATTCAGGTACCATGGATGCAATTGTGAAGATGATCCAATATGAAGGATTATCAAGCTTCTACAAAGGTATGAGCACCAAGATAGTACAGAGTGTATTTGCAGCCTCTGTGCTTTTCATGATCAAGGAAGAGCTGGTAAAGTTTTATGGAATGTTAGCAAAGAAGAGCCAAAAGATATTGTTAAAAATCTCAAACTAA 1074 41.34 MSNAVVNGLAGAGGGIIAQIITYPLQSVNTRQQTERIAKKSRSQGSSGGTLVQLIEVIRTEGIGGLYSGLKPSLLGTAASQGIYYYFYQVFKNKAESIAASNKRKGRGDGTVGMFSWLVVAALAGALNVLFTNPIWVLVTRMQTHTQAEQKILEAKKEALLRECSESSLIGTSLHDKLREIDSVKPNPYGTLHAAYEVYNEAGIRGFWKGIVPTLIMVCNPSIQFMIYETSLKYLKSKRADKKQSSSKVTALEVFVVGAIAKLGATVTTYPLLVVKSRLQAKQEISTSNSLRYSGTMDAIVKMIQYEGLSSFYKGMSTKIVQSVFAASVLFMIKEELVKFYGMLAKKSQKILLKISN 357
leaf

Annotation information

Select Seq ID Length Analysis Description Start End IPR GO
Mimi16g02079 357 ProSiteProfiles Solute carrier (Solcar) repeat profile. 2 94 IPR018108 -
Mimi16g02079 357 SUPERFAMILY Mitochondrial carrier 3 336 IPR023395 -
Mimi16g02079 357 ProSiteProfiles Solute carrier (Solcar) repeat profile. 112 234 IPR018108 -
Mimi16g02079 357 Gene3D Mitochondrial carrier domain 2 341 IPR023395 -
Mimi16g02079 357 ProSiteProfiles Solute carrier (Solcar) repeat profile. 249 340 IPR018108 -
Mimi16g02079 357 PANTHER MITOCHONDRIAL NICOTINAMIDE ADENINE DINUCLEOTIDE TRANSPORTER 1-RELATED-RELATED 3 351 IPR044712 GO:0006862(InterPro)|GO:0022857(PANTHER)|GO:0055085(InterPro)|GO:0055085(PANTHER)
Mimi16g02079 357 Pfam Mitochondrial carrier protein 189 238 IPR018108 -
Mimi16g02079 357 Pfam Mitochondrial carrier protein 4 93 IPR018108 -
Mimi16g02079 357 Pfam Mitochondrial carrier protein 249 341 IPR018108 -
leaf

Pathway information

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Mimi16g02079 K13354 solute carrier family 25 (peroxisomal adenine nucleotide transporter), member 17
leaf

Duplication type information

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
3981850 Mimi Mimi16g02079 Mimi-Chr16:82864065 Mimi6g01904 Mimi-Chr6:67075085
4008944 Mimi Mimi16g02079 Mimi-Chr16:82864065 Mimi14g00559 Mimi-Chr14:12484700
leaf

Gene Family Members

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Mimi19g00534 . 41 296 Chloroplast and Mitochondria gene family AT1G07030 29.845 1.24e-24 99.4
Mimi19g00833 . 33 338 Chloroplast and Mitochondria gene family AT1G25380 62.783 2.29e-133 395.0
Mimi19g01256 . 49 343 Chloroplast and Mitochondria gene family AT1G72820 67.677 1.26e-134 383.0
Mimi19g01319 . 4 187 Chloroplast and Mitochondria gene family AT1G17530 59.239 1.58e-67 202.0
Mimi19g01418 . 1 343 Chloroplast and Mitochondria gene family AT1G72820 68.696 6.79e-163 459.0
Mimi18g00082 . 76 407 Chloroplast and Mitochondria gene family AT2G28800 63.842 1.90e-155 450.0
Mimi18g00543 . 24 224 Chloroplast and Mitochondria gene family AT1G14730 63.682 3.65e-88 257.0
Mimi18g00988 . 1 239 Chloroplast and Mitochondria gene family AT3G54890 83.75 1.39e-145 405.0
Mimi18g01888 . 141 271 Chloroplast and Mitochondria gene family AT4G03320 38.931 8.55e-28 102.0
Mimi18g02280 . 26 270 Chloroplast and Mitochondria gene family AT5G40810 86.29 3.12e-149 432.0
Mimi17g00010 . 43 548 Chloroplast and Mitochondria gene family AT2G18710 79.727 0.0 814.0
Mimi17g00380 . 18 273 Chloroplast and Mitochondria gene family AT1G61520 87.5 2.33e-165 457.0
Mimi17g01195 . 11 123 Chloroplast and Mitochondria gene family AT1G07020 38.793 1.71e-09 51.2
Mimi17g01228 . 11 113 Chloroplast and Mitochondria gene family AT1G07020 41.593 2.42e-08 49.3
Mimi17g01351 . 1 346 Chloroplast and Mitochondria gene family AT1G72820 60.807 1.70e-140 399.0
Mimi17g01434 . 1 61 Chloroplast and Mitochondria gene family AT5G05370 66.667 1.13e-24 91.3
Mimi17g01441 . 1 71 Chloroplast and Mitochondria gene family AT5G05370 69.014 4.07e-34 109.0
Mimi17g01714 . 70 548 Chloroplast and Mitochondria gene family AT2G18710 83.716 0.0 811.0
Mimi17g02103 . 58 255 Chloroplast and Mitochondria gene family AT3G61470 58.586 6.66e-78 234.0
Mimi17g02688 ACH,WGDA 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.194 7.46e-169 465.0
Mimi17g02689 ACH,WGDA 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.94 1.94e-169 467.0
Mimi16g00428 WGDA 1 263 Chloroplast and Mitochondria gene family AT2G30160 69.057 1.19e-121 348.0
Mimi16g02079 . 37 306 Chloroplast and Mitochondria gene family AT1G25380 26.398 3.63e-30 116.0
Mimi16g02089 . 1 307 Chloroplast and Mitochondria gene family AT2G47490 75.0 1.60e-160 448.0
Mimi16g02403 WGDA 1 327 Chloroplast and Mitochondria gene family AT2G30160 70.427 1.15e-164 460.0
Mimi16g02487 . 51 449 Chloroplast and Mitochondria gene family AT2G28800 77.114 0.0 597.0
Mimi15g01048 ACH 49 228 Chloroplast and Mitochondria gene family AT5G38630 65.0 3.49e-85 251.0
Mimi15g01538 . 143 354 Chloroplast and Mitochondria gene family AT2G28800 19.731 5.95e-06 46.6
Mimi15g01949 . 45 254 Chloroplast and Mitochondria gene family AT3G61470 92.381 4.04e-147 410.0
Mimi14g01429 ACH 1 258 Chloroplast and Mitochondria gene family AT1G15820 80.233 2.87e-147 410.0
Mimi13g00859 . 24 325 Chloroplast and Mitochondria gene family AT1G76570 74.839 1.44e-175 487.0
Mimi13g00882 . 24 325 Chloroplast and Mitochondria gene family AT1G76570 67.868 4.19e-164 459.0
Mimi13g01190 . 55 254 Chloroplast and Mitochondria gene family AT3G61470 50.943 3.75e-67 207.0
Mimi13g01192 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 55.721 2.76e-75 227.0
Mimi13g01852 . 192 318 Chloroplast and Mitochondria gene family AT5G54290 85.039 9.51e-73 223.0
Mimi11g00697 . 2 280 Chloroplast and Mitochondria gene family AT4G10340 82.857 9.36e-155 431.0
Mimi11g01050 . 53 255 Chloroplast and Mitochondria gene family AT3G61470 52.217 1.82e-67 206.0
Mimi11g01270 . 62 361 Chloroplast and Mitochondria gene family AT5G14040 79.333 3.25e-180 502.0
Mimi11g01506 . 1 345 Chloroplast and Mitochondria gene family AT1G72820 70.231 7.40e-177 492.0
Mimi11g01510 . 1 345 Chloroplast and Mitochondria gene family AT1G72820 70.231 9.22e-177 492.0
Mimi10g01142 ACH 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.567 1.24e-170 470.0
Mimi10g01267 . 4 154 Chloroplast and Mitochondria gene family AT4G25570 45.752 2.11e-32 123.0
Mimi9g00445 . 33 254 Chloroplast and Mitochondria gene family AT3G61470 90.09 1.46e-148 414.0
Mimi8g00144 . 31 318 Chloroplast and Mitochondria gene family AT1G07030 30.612 6.01e-36 130.0
Mimi8g00246 . 2 263 Chloroplast and Mitochondria gene family AT2G05100 67.17 2.58e-120 344.0
Mimi6g00645 WGDA 29 296 Chloroplast and Mitochondria gene family AT2G47490 35.563 4.53e-42 145.0
Mimi6g01904 . 33 294 Chloroplast and Mitochondria gene family AT2G47490 25.17 5.46e-16 75.9
Mimi5g00189 . 1 356 Chloroplast and Mitochondria gene family AT5G14040 74.23 0.0 531.0
Mimi5g00944 . 1 346 Chloroplast and Mitochondria gene family AT1G72820 60.807 1.98e-140 399.0
Mimi4g01144 . 60 128 Chloroplast and Mitochondria gene family AT1G61520 52.703 2.17e-14 65.9
Mimi4g01176 . 1 265 Chloroplast and Mitochondria gene family AT2G05070 88.679 1.51e-178 490.0
Mimi4g01177 . 1 265 Chloroplast and Mitochondria gene family AT2G05070 89.434 0.0 496.0
Mimi4g01505 . 1 343 Chloroplast and Mitochondria gene family AT1G72820 66.57 1.32e-154 436.0
Mimi3g01052 ACH 1 210 Chloroplast and Mitochondria gene family AT1G15820 79.524 5.28e-117 332.0
Mimi3g01284 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 88.06 1.90e-167 462.0
Mimi3g01285 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 88.06 3.08e-168 464.0
Mimi3g01286 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 88.06 9.54e-168 462.0
Mimi3g01287 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 88.06 3.08e-168 464.0
Mimi3g01550 . 7 284 Chloroplast and Mitochondria gene family AT5G15640 55.036 6.82e-103 304.0
Mimi3g01713 . 42 307 Chloroplast and Mitochondria gene family AT3G27240 92.481 2.73e-173 478.0
Mimi3g02090 . 1 300 Chloroplast and Mitochondria gene family AT4G25700 64.557 2.10e-145 409.0
Mimi2g00496 . 6 267 Chloroplast and Mitochondria gene family AT1G29930 85.878 2.44e-167 461.0
Mimi1g01589 ACH 33 294 Chloroplast and Mitochondria gene family AT1G25380 28.873 3.66e-13 69.7
Mimi1g01866 . 2 373 Chloroplast and Mitochondria gene family AT5G14040 76.344 0.0 567.0
Mimi1g02025 . 1 251 Chloroplast and Mitochondria gene family AT2G17270 58.964 2.25e-107 310.0
Mimi1g02159 WGDA 1 267 Chloroplast and Mitochondria gene family AT1G29930 88.433 9.82e-172 473.0
Mimi1g02160 WGDA 1 267 Chloroplast and Mitochondria gene family AT1G29910 88.433 3.35e-171 471.0
Mimi1g02374 WGDA 29 300 Chloroplast and Mitochondria gene family AT2G47490 36.201 1.44e-42 147.0
Mimi1g02570 ACH 1 228 Chloroplast and Mitochondria gene family AT5G38630 65.789 3.23e-111 317.0
Mimi1g02719 . 1 307 Chloroplast and Mitochondria gene family AT5G40810 85.806 0.0 511.0
Mimi1g02750 . 2 373 Chloroplast and Mitochondria gene family AT5G14040 76.882 0.0 578.0
Mimi1g03565 WGDA 1 215 Chloroplast and Mitochondria gene family AT4G25570 69.767 2.00e-109 321.0