AGRP Logo

AGRP

Asteraceae Genomic Research Platform

Gene Search

Example:
Example:

Gene details

leaf

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Smso1g03582 ATGTCCAACGCCGTCGTCAATGGCCTTGCCGGAGCCGGCGGAGGTATGATTGCTCAAATCCTCACATATCCTCTCCAATCGGTCAACACGCGCCAACAGACGGAGAGAATCGCGAAGAAGTCTCGGTCTCGGGGATCATCTGGCGGTACACTTGTTCAATTACTTGAGGTTATACGAAGTGAAGGGATTGGAGGATTATACAGTGGCCTTAAGCCTTCTCTGCTTGGAACGGCTGCATCACAGGGCATTTATTATTATTTTTACCAGGTTTTTAAAAATAAAGCTGAAGCTATTGCAGCTTCTAATAAAAGGAAGGGTCGTGGAGATGGTACAGTTGGGATGCTCTCCTGGCTTGTTGTGGCTGCTTTAGCTGGGTCACTGAATGTACTGTTTACAAACCCAATATGGGTGCTTGTGACACGTATGCAGACACATACTCAAGCAGAACAGAAGATTCTAGAAGCAAAGAAGGAAGCTCTGTTAAGAGAATGTTCCGAGAGCAGTTTGATTGGTTCTTCTTTGCATGATAAGTTGCGTGAACTCGATTCAGTGAAGCCTAATCCTTATGGGACGTTGCATGCGGCACGTGAGGTTTATAACGAAGCTGGAATAAAGGGATTTTGGAAAGGCATTGTTCCAACTTTAATCATGGTATGCAATCCATCAATTCAATTCATGATCTATGAGACATCTCTGAAGTACTTGAAATCTAAACGCGCTGATAAGAAGCAAAGTTCAAGTAAAGTTAGTGCTCTGGAGGTATTTGTAGTAGGTGCCATTGCTAAACTTGGAGCAACTGTGACAACCTACCCTCTGTTAGTTGTAAAGTCAAGACTTCAAGCAAAGCAAGAAATAAGTACAAACAATTCATTGAGATATTCAGGTACCTTGGATGCAATTGTGAAGATGATTCATTATGAAGGATTATCAAGCTTCTACAAAGGAATGAGCACCAAGATAGTACAGAGTGTATTTGCAGCCTCTGTACTTTTCATGATCAAGGAGGAGTTGGTTAAGTTTTATGGAATGTTAGCAAAGAAGAGCTTGGCTTATTTTAAGAGATTTGGACTCGTTTAG 1077 42.15 MSNAVVNGLAGAGGGMIAQILTYPLQSVNTRQQTERIAKKSRSRGSSGGTLVQLLEVIRSEGIGGLYSGLKPSLLGTAASQGIYYYFYQVFKNKAEAIAASNKRKGRGDGTVGMLSWLVVAALAGSLNVLFTNPIWVLVTRMQTHTQAEQKILEAKKEALLRECSESSLIGSSLHDKLRELDSVKPNPYGTLHAAREVYNEAGIKGFWKGIVPTLIMVCNPSIQFMIYETSLKYLKSKRADKKQSSSKVSALEVFVVGAIAKLGATVTTYPLLVVKSRLQAKQEISTNNSLRYSGTLDAIVKMIHYEGLSSFYKGMSTKIVQSVFAASVLFMIKEELVKFYGMLAKKSLAYFKRFGLV 358
leaf

Annotation information

Select Seq ID Length Analysis Description Start End IPR GO
Smso1g03582 358 Gene3D Mitochondrial carrier domain 3 341 IPR023395 -
Smso1g03582 358 ProSiteProfiles Solute carrier (Solcar) repeat profile. 249 340 IPR018108 -
Smso1g03582 358 SUPERFAMILY Mitochondrial carrier 3 336 IPR023395 -
Smso1g03582 358 ProSiteProfiles Solute carrier (Solcar) repeat profile. 112 234 IPR018108 -
Smso1g03582 358 Pfam Mitochondrial carrier protein 4 93 IPR018108 -
Smso1g03582 358 Pfam Mitochondrial carrier protein 248 341 IPR018108 -
Smso1g03582 358 Pfam Mitochondrial carrier protein 189 238 IPR018108 -
Smso1g03582 358 PANTHER MITOCHONDRIAL NICOTINAMIDE ADENINE DINUCLEOTIDE TRANSPORTER 1-RELATED-RELATED 3 345 IPR044712 GO:0006862(InterPro)|GO:0022857(PANTHER)|GO:0055085(PANTHER)|GO:0055085(InterPro)
Smso1g03582 358 ProSiteProfiles Solute carrier (Solcar) repeat profile. 2 94 IPR018108 -
leaf

Pathway information

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Smso1g03582 K13354 solute carrier family 25 (peroxisomal adenine nucleotide transporter), member 17
leaf

Duplication type information

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
4967729 Smso Smso1g03582 Smso-Chr1:120941724 Smso8g03413 Smso-Chr8:103482093
5013954 Smso Smso1g03582 Smso-Chr1:120941724 Smso25g01887 Smso-Chr25:54927303
leaf

Gene Family Members

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Smso29g00095 . 18 273 Chloroplast and Mitochondria gene family AT1G61520 87.5 6.94e-168 463.0
Smso29g01202 . 3 143 Chloroplast and Mitochondria gene family AT1G07020 45.205 3.01e-23 87.4
Smso29g01331 ACH,SST 68 346 Chloroplast and Mitochondria gene family AT1G72820 60.932 3.60e-102 299.0
Smso29g01340 ACH 1 72 Chloroplast and Mitochondria gene family AT5G05370 69.444 6.07e-35 111.0
Smso29g01389 . 42 323 Chloroplast and Mitochondria gene family AT2G30160 73.498 5.80e-148 416.0
Smso29g01455 . 11 258 Chloroplast and Mitochondria gene family AT5G15640 42.742 4.70e-58 186.0
Smso28g00160 SST,WGDA 51 405 Chloroplast and Mitochondria gene family AT2G28800 82.961 0.0 603.0
Smso28g00209 . 510 580 Chloroplast and Mitochondria gene family AT4G21490 40.789 2.11e-13 61.6
Smso28g00229 ACH,SST,WGDA 1 329 Chloroplast and Mitochondria gene family AT2G30160 70.909 1.95e-166 464.0
Smso28g00488 SST,WGDA 1 307 Chloroplast and Mitochondria gene family AT2G47490 75.974 1.12e-163 456.0
Smso28g00700 . 106 266 Chloroplast and Mitochondria gene family AT2G34430 89.441 2.71e-99 285.0
Smso28g00702 . 109 266 Chloroplast and Mitochondria gene family AT2G34430 89.873 1.14e-100 291.0
Smso27g00353 SST 33 354 Chloroplast and Mitochondria gene family AT5G54290 72.981 3.27e-147 419.0
Smso27g00433 ACH 1 367 Chloroplast and Mitochondria gene family AT5G14040 70.3 0.0 533.0
Smso27g00604 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 55.721 4.97e-75 227.0
Smso26g00533 WGDA 24 330 Chloroplast and Mitochondria gene family AT4G21490 60.323 4.87e-117 348.0
Smso26g00668 . 34 252 Chloroplast and Mitochondria gene family AT3G61470 91.324 1.62e-148 414.0
Smso26g01241 ACH,SST,WGDA 47 548 Chloroplast and Mitochondria gene family AT2G18710 81.496 0.0 832.0
Smso26g01849 . 106 273 Chloroplast and Mitochondria gene family AT1G61520 90.476 2.80e-110 316.0
Smso26g02415 . 1 239 Chloroplast and Mitochondria gene family AT3G54890 84.232 1.23e-143 400.0
Smso26g02748 ACH,SST,WGDA 33 327 Chloroplast and Mitochondria gene family AT1G25380 65.449 7.25e-140 399.0
Smso25g00801 . 1 265 Chloroplast and Mitochondria gene family AT2G05070 88.679 2.80e-180 496.0
Smso25g00802 . 1 265 Chloroplast and Mitochondria gene family AT2G05070 80.0 3.16e-156 433.0
Smso25g01300 SST,WGDA 11 309 Chloroplast and Mitochondria gene family AT2G17270 63.88 2.23e-148 417.0
Smso25g01367 SST,WGDA 29 300 Chloroplast and Mitochondria gene family AT2G47490 36.842 2.23e-47 159.0
Smso25g01527 ACH,SST,WGDA 9 228 Chloroplast and Mitochondria gene family AT5G38630 71.818 7.51e-116 328.0
Smso25g01887 SST 37 310 Chloroplast and Mitochondria gene family AT1G25380 25.733 1.19e-27 109.0
Smso25g02335 WGDA 1 374 Chloroplast and Mitochondria gene family AT5G14040 77.005 0.0 571.0
Smso24g00355 SST,WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 70.52 7.87e-166 464.0
Smso24g00472 SST,WGDA 3 187 Chloroplast and Mitochondria gene family AT1G17530 62.162 4.21e-70 209.0
Smso24g00874 SST,WGDA 110 257 Chloroplast and Mitochondria gene family AT1G15820 86.486 8.06e-92 266.0
Smso24g00992 . 45 271 Chloroplast and Mitochondria gene family AT4G03320 35.931 1.36e-41 144.0
Smso24g01596 ACH,SST 1 227 Chloroplast and Mitochondria gene family AT5G38630 65.198 3.33e-108 310.0
Smso24g02395 . 152 252 Chloroplast and Mitochondria gene family AT3G61470 96.04 1.05e-67 206.0
Smso24g02910 SST 128 236 Chloroplast and Mitochondria gene family AT1G26100 62.385 1.80e-33 114.0
Smso24g02911 SST 54 124 Chloroplast and Mitochondria gene family AT1G26100 70.27 5.76e-28 102.0
Smso23g00882 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.313 2.47e-171 472.0
Smso23g00883 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.313 1.01e-170 470.0
Smso23g00884 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.313 2.47e-171 472.0
Smso23g00885 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.313 9.93e-171 470.0
Smso23g01469 . 2 265 Chloroplast and Mitochondria gene family AT2G05100 67.416 1.31e-122 348.0
Smso23g01470 . 2 265 Chloroplast and Mitochondria gene family AT2G05100 67.416 1.27e-122 348.0
Smso22g01200 ACH,SST,WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 85.993 0.0 515.0
Smso22g01429 SST 7 320 Chloroplast and Mitochondria gene family AT5G15640 74.204 3.42e-179 496.0
Smso22g01430 SST 7 320 Chloroplast and Mitochondria gene family AT5G15640 71.975 1.13e-174 485.0
Smso22g01928 . 38 251 Chloroplast and Mitochondria gene family AT3G61470 47.465 6.75e-62 194.0
Smso22g02342 ACH,SST 1 361 Chloroplast and Mitochondria gene family AT5G14040 70.36 0.0 505.0
Smso22g02590 SST 1 343 Chloroplast and Mitochondria gene family AT1G72820 69.516 7.28e-175 488.0
Smso21g00270 . 1 224 Chloroplast and Mitochondria gene family AT1G14730 61.607 1.16e-94 274.0
Smso21g00271 ACH,SST 4 214 Chloroplast and Mitochondria gene family AT4G25570 44.55 7.91e-63 194.0
Smso21g00394 ACH,SST,WGDA 61 206 Chloroplast and Mitochondria gene family AT1G25380 58.219 6.57e-52 166.0
Smso21g00661 ACH,SST 76 407 Chloroplast and Mitochondria gene family AT2G28800 63.559 2.49e-157 455.0
Smso21g00805 . 1 239 Chloroplast and Mitochondria gene family AT3G54890 61.57 2.53e-93 271.0
Smso21g01471 ACH,WGDA 4 211 Chloroplast and Mitochondria gene family AT4G25570 43.269 7.62e-58 181.0
Smso21g01584 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.891 2.59e-171 471.0
Smso21g01585 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.266 8.09e-172 473.0
Smso21g02135 . 15 287 Chloroplast and Mitochondria gene family AT5G01530 84.249 1.16e-164 458.0
Smso21g02136 . 15 287 Chloroplast and Mitochondria gene family AT5G01530 84.615 1.50e-164 458.0
Smso20g00446 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.687 1.39e-171 472.0
Smso20g00447 . 6 267 Chloroplast and Mitochondria gene family AT1G29930 86.692 1.97e-167 462.0
Smso20g01143 . 51 257 Chloroplast and Mitochondria gene family AT3G61470 66.667 2.16e-101 294.0
Smso20g01560 . 1 327 Chloroplast and Mitochondria gene family AT2G30160 71.646 1.15e-168 470.0
Smso19g00387 . 6 267 Chloroplast and Mitochondria gene family AT1G29930 87.072 2.18e-168 464.0
Smso19g00543 ACH,SST,WGDA 4 177 Chloroplast and Mitochondria gene family AT4G25570 44.253 1.56e-50 161.0
Smso19g01381 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 81.716 6.88e-156 432.0
Smso19g01382 . 104 181 Chloroplast and Mitochondria gene family AT2G34420 89.744 9.66e-45 143.0
Smso19g01384 . 191 266 Chloroplast and Mitochondria gene family AT2G34430 85.526 4.86e-39 129.0
Smso18g00735 . 210 243 Chloroplast and Mitochondria gene family AT5G40810 88.235 1.26e-14 66.6
Smso18g01155 ACH 1 258 Chloroplast and Mitochondria gene family AT1G15820 79.151 7.19e-148 412.0
Smso18g01536 . 1 265 Chloroplast and Mitochondria gene family AT2G05100 89.811 0.0 499.0
Smso18g01539 . 1 265 Chloroplast and Mitochondria gene family AT2G05100 89.811 0.0 496.0
Smso17g01266 . 32 280 Chloroplast and Mitochondria gene family AT4G10340 89.243 7.66e-148 413.0
Smso17g01268 . 2 280 Chloroplast and Mitochondria gene family AT4G10340 85.409 1.25e-151 425.0
Smso17g01686 ACH 32 184 Chloroplast and Mitochondria gene family AT5G40810 81.529 2.65e-84 250.0
Smso17g02047 . 1 307 Chloroplast and Mitochondria gene family AT5G40810 86.319 0.0 516.0
Smso17g02169 . 11 265 Chloroplast and Mitochondria gene family AT5G15640 64.0 2.58e-125 359.0
Smso17g02643 . 1 300 Chloroplast and Mitochondria gene family AT4G25700 65.506 1.38e-145 410.0
Smso17g03395 ACH,SST 2 364 Chloroplast and Mitochondria gene family AT5G14040 75.824 0.0 556.0
Smso16g00611 . 55 147 Chloroplast and Mitochondria gene family AT5G15640 60.638 2.36e-35 121.0
Smso16g00990 . 1 264 Chloroplast and Mitochondria gene family AT1G29930 76.136 2.25e-135 384.0
Smso16g00991 . 1 266 Chloroplast and Mitochondria gene family AT2G34430 86.466 5.16e-168 463.0
Smso16g01000 . 1 266 Chloroplast and Mitochondria gene family AT2G34430 87.97 6.15e-170 468.0
Smso16g01001 . 95 266 Chloroplast and Mitochondria gene family AT2G34430 79.651 6.32e-94 272.0
Smso16g01327 ACH,SST,WGDA 1 258 Chloroplast and Mitochondria gene family AT1G15820 80.843 5.50e-151 420.0
Smso16g01896 SST,WGDA 5 187 Chloroplast and Mitochondria gene family AT1G17530 63.636 1.75e-72 215.0
Smso16g02002 SST,WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 70.317 8.21e-169 472.0
Smso15g00161 . 79 286 Chloroplast and Mitochondria gene family AT1G25380 28.511 9.45e-10 56.6
Smso15g00565 . 134 168 Chloroplast and Mitochondria gene family AT2G30160 77.778 2.30e-12 60.5
Smso15g01235 WGDA 1 307 Chloroplast and Mitochondria gene family AT5G40810 85.993 0.0 513.0
Smso15g01706 . 32 280 Chloroplast and Mitochondria gene family AT4G10340 88.446 4.51e-148 416.0
Smso15g01707 . 2 280 Chloroplast and Mitochondria gene family AT4G10340 84.342 1.24e-150 421.0
Smso15g02144 ACH 26 270 Chloroplast and Mitochondria gene family AT5G40810 76.613 4.16e-127 361.0
Smso14g00539 . 245 308 Chloroplast and Mitochondria gene family AT5G14040 71.875 2.98e-30 108.0
Smso14g01422 ACH,SST,WGDA 21 307 Chloroplast and Mitochondria gene family AT5G40810 88.502 5.73e-179 494.0
Smso14g01705 . 7 320 Chloroplast and Mitochondria gene family AT5G15640 74.204 5.25e-179 496.0
Smso14g01706 SST 112 263 Chloroplast and Mitochondria gene family AT5G15640 73.684 7.00e-79 234.0
Smso14g01707 SST 7 61 Chloroplast and Mitochondria gene family AT5G15640 67.273 7.57e-22 85.1
Smso14g02253 . 38 254 Chloroplast and Mitochondria gene family AT3G61470 46.364 4.90e-61 192.0
Smso14g02457 . 35 255 Chloroplast and Mitochondria gene family AT3G61470 52.036 4.21e-75 227.0
Smso14g02695 ACH,SST 1 361 Chloroplast and Mitochondria gene family AT5G14040 70.36 0.0 508.0
Smso14g02958 SST 1 345 Chloroplast and Mitochondria gene family AT1G72820 70.255 3.74e-178 496.0
Smso13g00160 . 108 273 Chloroplast and Mitochondria gene family AT1G61520 92.169 7.40e-111 315.0
Smso13g00675 ACH,SST,WGDA 43 548 Chloroplast and Mitochondria gene family AT2G18710 80.664 0.0 829.0
Smso13g01023 . 33 254 Chloroplast and Mitochondria gene family AT3G61470 91.441 2.10e-150 419.0
Smso12g00077 SST 1 239 Chloroplast and Mitochondria gene family AT4G25570 64.854 1.16e-110 316.0
Smso12g00898 SST,WGDA 2 373 Chloroplast and Mitochondria gene family AT5G14040 77.419 0.0 582.0
Smso12g00944 ACH,SST 1 307 Chloroplast and Mitochondria gene family AT5G40810 86.129 0.0 516.0
Smso12g01305 SST,WGDA 29 300 Chloroplast and Mitochondria gene family AT2G47490 36.786 2.97e-48 162.0
Smso12g01578 SST 33 294 Chloroplast and Mitochondria gene family AT1G25380 29.123 4.27e-13 67.4
Smso12g02443 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.567 1.17e-171 473.0
Smso12g03333 ACH,SST,WGDA 4 211 Chloroplast and Mitochondria gene family AT4G25570 43.269 6.62e-54 171.0
Smso12g03958 . 112 151 Chloroplast and Mitochondria gene family AT5G15640 67.5 7.18e-14 63.2
Smso12g04148 . 31 245 Chloroplast and Mitochondria gene family AT1G76570 76.279 5.11e-124 353.0
Smso11g00016 . 25 325 Chloroplast and Mitochondria gene family AT1G76570 76.744 4.86e-178 493.0
Smso11g00456 . 71 149 Chloroplast and Mitochondria gene family AT5G15640 58.228 3.78e-25 93.6
Smso11g01462 SST 33 294 Chloroplast and Mitochondria gene family AT1G25380 29.474 4.39e-13 67.4
Smso11g01743 SST,WGDA 33 308 Chloroplast and Mitochondria gene family AT1G25380 35.088 3.41e-48 163.0
Smso11g01946 ACH,WGDA 1 228 Chloroplast and Mitochondria gene family AT5G38630 67.982 2.35e-114 325.0
Smso11g02122 ACH,SST 1 307 Chloroplast and Mitochondria gene family AT5G40810 75.484 1.21e-152 430.0
Smso11g02176 ACH,SST,WGDA 5 373 Chloroplast and Mitochondria gene family AT5G14040 78.049 0.0 581.0
Smso11g03053 SST 1 239 Chloroplast and Mitochondria gene family AT4G25570 64.854 7.37e-111 316.0
Smso10g00391 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.313 5.26e-171 471.0
Smso10g00392 . 6 267 Chloroplast and Mitochondria gene family AT1G29930 86.312 6.11e-167 460.0
Smso10g00985 . 51 255 Chloroplast and Mitochondria gene family AT3G61470 67.317 2.12e-101 295.0
Smso10g01428 ACH,SST,WGDA 65 548 Chloroplast and Mitochondria gene family AT2G18710 83.058 0.0 819.0
Smso10g02975 . 1 343 Chloroplast and Mitochondria gene family AT1G72820 70.029 2.81e-167 468.0
Smso10g02976 SST,WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 70.029 2.81e-167 468.0
Smso10g03105 SST,WGDA 5 187 Chloroplast and Mitochondria gene family AT1G17530 64.706 9.14e-74 218.0
Smso10g03588 ACH,SST,WGDA 1 258 Chloroplast and Mitochondria gene family AT1G15820 82.375 7.34e-153 426.0
Smso10g03822 . 75 266 Chloroplast and Mitochondria gene family AT2G34430 91.667 2.87e-128 360.0
Smso10g03930 . 15 287 Chloroplast and Mitochondria gene family AT5G01530 84.982 1.17e-162 454.0
Smso8g00255 . 104 270 Chloroplast and Mitochondria gene family AT4G03320 41.279 3.90e-41 142.0
Smso8g01243 ACH,SST 1 364 Chloroplast and Mitochondria gene family AT5G14040 76.099 0.0 563.0
Smso8g02207 . 179 218 Chloroplast and Mitochondria gene family AT4G25700 75.0 9.98e-17 70.5
Smso8g02410 . 21 300 Chloroplast and Mitochondria gene family AT4G25700 68.166 3.77e-143 409.0
Smso8g02630 SST,WGDA 14 301 Chloroplast and Mitochondria gene family AT2G17270 63.889 3.58e-140 397.0
Smso8g02709 SST,WGDA 29 300 Chloroplast and Mitochondria gene family AT2G47490 37.544 1.69e-47 160.0
Smso8g02892 ACH,SST,WGDA 1 228 Chloroplast and Mitochondria gene family AT5G38630 71.491 2.63e-119 337.0
Smso8g03413 SST 37 310 Chloroplast and Mitochondria gene family AT1G25380 26.623 3.77e-28 110.0
Smso7g00087 . 18 273 Chloroplast and Mitochondria gene family AT1G61520 88.281 2.18e-169 468.0
Smso7g01336 SST 24 233 Chloroplast and Mitochondria gene family AT1G72820 63.333 5.44e-79 239.0
Smso7g01800 SST,WGDA 42 548 Chloroplast and Mitochondria gene family AT2G18710 80.117 0.0 830.0
Smso7g02258 . 15 287 Chloroplast and Mitochondria gene family AT5G01530 84.982 1.41e-162 451.0
Smso6g00041 ACH,SST 1 236 Chloroplast and Mitochondria gene family AT1G26100 65.447 1.29e-96 280.0
Smso6g00553 . 32 254 Chloroplast and Mitochondria gene family AT3G61470 90.135 1.51e-149 416.0
Smso6g01441 ACH,SST 1 230 Chloroplast and Mitochondria gene family AT5G38630 63.913 1.60e-107 308.0
Smso5g00154 . 136 169 Chloroplast and Mitochondria gene family AT2G30160 74.286 8.74e-09 56.2
Smso5g00156 . 136 169 Chloroplast and Mitochondria gene family AT2G30160 74.286 8.74e-09 56.2
Smso5g00382 SST,WGDA 1 343 Chloroplast and Mitochondria gene family AT1G72820 71.098 3.17e-168 471.0
Smso5g00492 SST,WGDA 5 187 Chloroplast and Mitochondria gene family AT1G17530 61.957 1.02e-69 208.0
Smso5g00968 SST,WGDA 1 258 Chloroplast and Mitochondria gene family AT1G15820 81.008 9.41e-150 416.0
Smso5g01696 . 1 239 Chloroplast and Mitochondria gene family AT3G54890 82.5 4.76e-144 401.0
Smso5g02110 ACH,SST,WGDA 33 327 Chloroplast and Mitochondria gene family AT1G25380 64.784 1.14e-139 399.0
Smso4g00242 ACH,SST 1 224 Chloroplast and Mitochondria gene family AT1G14730 61.607 2.61e-94 273.0
Smso4g00361 ACH,SST,WGDA 35 240 Chloroplast and Mitochondria gene family AT1G25380 58.173 9.98e-81 242.0
Smso4g00645 ACH,SST 76 407 Chloroplast and Mitochondria gene family AT2G28800 63.559 3.72e-156 452.0
Smso4g01596 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.891 2.27e-171 472.0
Smso4g01598 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 87.64 1.94e-172 474.0
Smso4g01911 WGDA 247 304 Chloroplast and Mitochondria gene family AT4G21490 72.414 3.54e-24 91.7
Smso4g02088 . 105 155 Chloroplast and Mitochondria gene family AT2G47490 61.538 5.42e-11 56.2
Smso4g02101 . 169 210 Chloroplast and Mitochondria gene family AT5G14040 61.905 2.23e-06 48.1
Smso4g02226 . 15 287 Chloroplast and Mitochondria gene family AT5G01530 83.883 2.99e-163 455.0
Smso3g00367 SST 37 354 Chloroplast and Mitochondria gene family AT5G54290 72.327 3.92e-145 412.0
Smso3g00642 . 55 255 Chloroplast and Mitochondria gene family AT3G61470 56.219 2.13e-75 228.0
Smso3g02240 . 47 129 Chloroplast and Mitochondria gene family AT2G30160 59.036 6.55e-26 97.4
Smso2g00595 . 12 316 Chloroplast and Mitochondria gene family AT1G07030 29.642 1.29e-34 132.0
Smso2g01635 . 106 266 Chloroplast and Mitochondria gene family AT2G34430 90.062 1.17e-102 293.0
Smso2g01636 . 106 266 Chloroplast and Mitochondria gene family AT2G34430 91.304 1.49e-104 298.0
Smso2g01637 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.94 8.61e-170 468.0
Smso2g01852 . 1 303 Chloroplast and Mitochondria gene family AT2G17270 66.337 1.35e-158 443.0
Smso2g01935 . 203 241 Chloroplast and Mitochondria gene family AT5G40810 76.923 9.03e-14 65.1
Smso2g02219 ACH 2 373 Chloroplast and Mitochondria gene family AT5G14040 77.151 0.0 576.0
Smso2g02740 . 2 265 Chloroplast and Mitochondria gene family AT2G05100 67.79 3.30e-123 350.0
Smso2g02741 . 3 265 Chloroplast and Mitochondria gene family AT2G05100 66.541 5.36e-117 346.0
Smso1g01115 . 1 267 Chloroplast and Mitochondria gene family AT1G29930 86.142 4.16e-169 466.0
Smso1g02124 . 1 265 Chloroplast and Mitochondria gene family AT2G05100 89.434 3.41e-179 491.0
Smso1g02127 . 1 265 Chloroplast and Mitochondria gene family AT2G05100 89.434 2.22e-180 494.0
Smso1g02208 . 200 246 Chloroplast and Mitochondria gene family AT1G61520 61.702 2.29e-13 63.2
Smso1g03495 . 165 246 Chloroplast and Mitochondria gene family AT1G61520 37.647 3.20e-08 49.3
Smso1g03582 . 37 306 Chloroplast and Mitochondria gene family AT1G25380 26.087 3.81e-29 114.0
Smso1g03601 SST,WGDA 1 307 Chloroplast and Mitochondria gene family AT2G47490 76.299 4.04e-164 457.0
Smso1g03951 ACH 1 71 Chloroplast and Mitochondria gene family AT5G05370 61.972 3.16e-30 102.0
Smso1g04006 SST,WGDA 1 323 Chloroplast and Mitochondria gene family AT2G30160 70.988 3.32e-164 459.0
Smso1g04108 SST,WGDA 51 449 Chloroplast and Mitochondria gene family AT2G28800 77.667 0.0 603.0